Raw content of Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor
<![CDATA[=head1 LICENSE
Copyright (c) 1999-2009 The European Bioinformatics Institute and
Genome Research Limited. All rights reserved.
This software is distributed under a modified Apache license.
For license details, please see
/info/about/code_licence.html
=head1 CONTACT
Please email comments or questions to the public Ensembl
developers list at <ensembl-dev@ebi.ac.uk>.
Questions may also be sent to the Ensembl help desk at
<helpdesk@ensembl.org>.
=cut
=head1 NAME
Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor - Facilitates DB storage and retrieval of compressed sequence
=head1 SYNOPSIS
$seq_adptr = $database_adaptor->get_SequenceAdaptor();
$dna =
${ $seq_adptr->fetch_by_Slice_start_end_strand( $slice, 1, 1000,
-1 ) };
=head1 DESCRIPTION
An adaptor for the retrieval of compressed DNA sequence from the EnsEMBL
database
=head1 METHODS
=cut
package Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor;
use vars qw(@ISA);
use strict;
use Bio::EnsEMBL::DBSQL::SequenceAdaptor;
@ISA = qw(Bio::EnsEMBL::DBSQL::SequenceAdaptor);
sub _fetch_seq {
my $self = shift;
my $seq_region_id = shift;
my $start = shift;
my $len = shift;
#calculate the offset and start in the compressed sequence
my $comp_start = ($start-1 >> 2) + 1;
my $comp_len = ($len >> 2) + 2;
my ($bvector, $nline);
my $sth = $self->prepare(
"SELECT SUBSTRING( d.sequence, ?, ?), n_line
FROM dnac d
WHERE d.seq_region_id = ?");
$sth->bind_param(1,$comp_start,SQL_INTEGER);
$sth->bind_param(2,$comp_len ,SQL_INTEGER);
$sth->bind_param(3,$seq_region_id,SQL_INTEGER);
$sth->execute();
$sth->bind_columns(\$bvector, \$nline);
$sth->fetch();
$sth->finish();
#convert sequence from binary string to 0123 string
my $bitlen = length($bvector) << 2;
my $str = '';
for(my $i=0; $i < $bitlen; $i++) {
$str .= vec($bvector, $i, 2);
}
#convert from 0123 to ACTG
$str =~ tr/0123/ACTG/;
$str = substr($str, ($start-1)%4, $len);
#expand the nlines and place them back in the sequence
my @nlines = split(/:/, $nline);
foreach my $nl (@nlines) {
my ($offset,$char,$nlen) = $nl =~ /(\d+)(\D)(\d+)/;
#skip nlines entirely out of range
next if(($offset+$nlen-1) < $start || $offset > ($start+$len-1));
#obtain relative offset into requested region
$offset = $offset - $start + 1;
#nlines that partially overlap requested region have to be shrunk
if($offset < 1) {
$nlen = $nlen - (1-$offset);
$offset = 1;
}
if($offset + $nlen > $start+$len) {
$nlen = $len - $offset + 1;
}
substr($str,$offset-1,$nlen) = $char x $nlen;
}
return \$str;
}
=head2 store
Arg [1] : string $seq_region_id the id of the sequence region this dna
will be associated with.
Arg [2] : string reference $sequence the dna sequence to be stored in
the database
Example : $dbID = $seq_adaptor->store(12,\'ACTGGGTACCAAACAAACACAACA');
Description: stores a dna sequence in the databases dna table and returns the
database identifier for the new record.
Returntype : int
Exceptions : none
Caller : Bio::EnsEMBL::DBSQL::RawContigAdaptor::store
Status : Stable
=cut
sub store {
my ($self, $seq_region_id, $sequence) = @_;
if(!$seq_region_id) {
throw('seq_region_id is required');
}
$sequence = uc($sequence);
my $bvector = '';
#convert sequence to 0s,1s,2s and 3s
$sequence =~ tr/ACTG/0123/;
#nlines cover sequence which is not ACTG such as N
#nline format is a set of colon delimited int, char, int triplets:
#<offset><code><length>
my($nline_char,$nline_len,$nline_off);
my @nlines;
my $len = length($sequence);
for(my $i=0; $i < $len; $i++) {
my $char = substr($sequence,$i,1);
#quickly check if this character was an A,C,T or G (and was converted to
# a 0,1,2,3)
if($char =~ /[0-3]/) {
vec($bvector, $i,2) = $char;
if($nline_char) {
#end of an nline
push @nlines, "$nline_off$nline_char$nline_len";
$nline_char = undef;
$nline_len = 0;
$nline_off = 0;
}
} else {
#this was not an ACTG
if($nline_char) {
if($nline_char eq $char) {
#continuation of an nline
$nline_len++;
} else {
#end of a previous nline and start of a new one
push @nlines, "$nline_off$nline_char$nline_len";
$nline_char = $char;
$nline_len = 1;
$nline_off = $i+1;
}
} else {
#start of a new nline
$nline_char = $char;
$nline_len = 1;
$nline_off = $i+1;
}
$char = 0; #need to put numeric val into bitvector despite nline
}
vec($bvector, $i,2) = $char;
}
my $nline = join(':', @nlines);
my $statement = $self->prepare(
"INSERT INTO dnac(seq_region_id, sequence, n_line) VALUES(?,?,?)");
$statement->bind_param(1,$seq_region_id,SQL_INTEGER);
$statement->bind_param(2,$bvector,SQL_BLOB);
$statement->bind_param(3,$nline,SQL_LONGVARCHAR);
$statement->execute();
$statement->finish();
return;
}
1;
]]>