Raw content of Bio::Map::Microsatellite
<![CDATA[# BioPerl module for Bio::Map::Microsatellite
#
# Cared for by Chad Matsalla <bioinformatics1@dieselwurks.com>
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Map::Microsatellite - An object representing a Microsatellite marker.
=head1 SYNOPSIS
$o_usat = new Bio::Map::Microsatellite
(-name=>'Chad Super Marker 2',
-sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
-motif => 'at',
-repeats => 15,
-repeat_start_position => 11
);
$sequence_before_usat = $o_usat->get_leading_flank();
$sequence_after_usat = $o_usat->get_trailing_flank();
=head1 DESCRIPTION
This object handles the notion of an Microsatellite. This microsatellite can
be placed on a (linear) Map or used on its own. If this Microsatellites
will be used in a mapping context (it doesn't have to, you know) it can have
multiple positions in a map. For information about a Microsatellite's position
in a map one must query the associate PositionI object which is accessible
through the position() method.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/MailList.shtml - About the mailing lists
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
email or the web:
bioperl-bugs@bioperl.org
http://bugzilla.bioperl.org/
=head1 AUTHOR - Chad Matsalla
Email bioinformatics1@dieselwurks.com
=head1 CONTRIBUTORS
Heikki Lehvaslaiho heikki@ebi.ac.uk
Lincoln Stein lstein@cshl.org
Jason Stajich jason@bioperl.org
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Map::Microsatellite;
use vars qw(@ISA);
use strict;
use Bio::Root::Root;
use Bio::Map::Marker;
@ISA = qw(Bio::Map::Marker);
=head2 new
Title : new
Usage : $o_usat =
Function: Builds a new Bio::Map::Microsatellite object
Returns : Bio::Map::Microsatellite
Args :
-name => name of this microsatellite (optional, string,
default 'Unknown microsatellite')
-positions => position(s) for this marker in maps[optional],
An array reference of tuples (array refs themselves)
Each tuple conatins a Bio::Map::MapI-inherited object and a
Bio::Map::PositionI-inherited obj, no default)
-sequence => the sequence of this microsatellite (optional,
scalar, no default)
-motif => the repeat motif of this microsatellite (optional,
scalar, no default)
-repeats => the number of motif repeats for this microsatellite
(optional, scalar, no default)
-repeat_start_position => the starting position of the
microsatellite in this sequence. The first base of the
sequence is position "1". (optional, scalar, no default)
Note : Creating a Bio::Map::Microsatellite object with no position
might be useful for microsatellite people wanting to embrace
and extend this module. <raising hand> Me! Me! Me!
- using repeat_start_position will trigger a mechinism to
calculate a value for repeat_end_position.
=cut
sub new {
my ($class,@args) = @_;
my $self = $class->SUPER::new(@args);
my ($map, $position, $sequence, $motif, $repeats, $start) =
$self->_rearrange([qw(MAP
POSITION
SEQUENCE
MOTIF
REPEATS
REPEAT_START_POSITION
)], @args);
if( ! $self->name ) {
$self->name('Unnamed microsatellite');
}
$map && $self->map($map);
$position && $self->position($position);
$sequence && $self->sequence($sequence);
$self->motif(defined $motif ? $motif : 'Unknown motif');
$repeats && $self->repeats($repeats);
$start && $self->repeat_start_position($start);
return $self;
}
=head2 Bio::Map::Marker methods
=cut
=head2 position
Title : position
Usage : my $position = $mappable->position($map); OR
$mappable->position($map,$position); OR
Function: Get/Set the Bio::Map::PositionI for a mappable element
in a specific Map
Returns : Bio::Map::PositionI
Args : $map =Bio::Map::MapI # Map we are talking about
$position = Bio::Map::PositionI # Position we want to set
=head2 name($new_name)
Title : name($new_name)
Usage : $o_usat->name($new_name) _or_
my $name = $o_usat->name()
Function: Get/Set the name for this Microsatellite
Returns : A scalar representing the current name of this Microsatellite
Args : If provided, the current name of this Microsatellite
will be set to $new_name.
=head2 motif($new_motif)
Title : motif($new_motif)
Usage : my $motif = $o_usat->motif($new_motif) _or_
my $motif = $o_usat->motif()
Function: Get/Set the repeat motif for this Microsatellite
Returns : A scalar representing the current repeat motif of this
Microsatellite.
Args : If provided, the current repeat motif of this Microsatellite
will be set to $new_motif.
=cut
sub motif {
my ($self,$motif) = @_;
if ($motif) {
$self->{'_motif'} = $motif;
}
return $self->{'_motif'};
}
=head2 sequence($new_sequence)
Title : sequence($new_sequence)
Usage : my $sequence = $o_usat->sequence($new_sequence) _or_
my $sequence = $o_usat->sequence()
Function: Get/Set the sequence for this Microsatellite
Returns : A scalar representing the current sequence of this
Microsatellite.
Args : If provided, the current sequence of this Microsatellite
will be set to $new_sequence.
=cut
sub sequence {
my ($self,$sequence) = @_;
if ($sequence) {
$self->{'_sequence'} = $sequence;
}
return $self->{'_sequence'};
}
=head2 repeats($new_repeats)
Title : repeats($new_repeats)
Usage : my $repeats = $o_usat->repeats($new_repeats) _or_
my $repeats = $o_usat->repeats()
Function: Get/Set the repeat repeats for this Microsatellite
Returns : A scalar representing the current number of repeats of this
Microsatellite.
Args : If provided, the current number of repeats of this
Microsatellite will be set to $new_repeats.
=cut
sub repeats {
my ($self,$repeats) = @_;
if ($repeats) {
$self->{'_repeats'} = $repeats;
}
return $self->{'_repeats'};
}
=head2 repeat_start_position($new_repeat_start_position)
Title : repeat_start_position($new_repeat_start_position)
Usage : my $repeat_start_position =
$o_usat->repeat_start_position($new_repeat_start_position) _or_
my $repeat_start_position = $o_usat->repeat_start_position()
Function: Get/Set the repeat repeat_start_position for this
Microsatellite
Returns : A scalar representing the repeat start position for this
Microsatellite.
Args : If provided, the current repeat start position of this
Microsatellite will be set to $new_repeat_start_position.
This method will also try to set the repeat end position. This
depends on having information for the motif and the number of
repeats. If you want to use methods like get_trailing_flank or
get_leading flank, be careful to include the right information.
=cut
sub repeat_start_position {
my ($self,$repeat_start_position) = @_;
if ($repeat_start_position) {
$self->{'_repeat_start_position'} = $repeat_start_position;
$self->repeat_end_position("set");
}
return $self->{'_repeat_start_position'};
}
=head2 repeat_end_position($value)
Title : repeat_end_position($set)
Usage : $new_repeat_end_position =
$o_usat->repeat_end_position("set"); _or_
$new_repeat_end_position =
$o_usat->repeat_end_position($value); _or_
$current_repeat_end_position = $o_usat->repeat_end_position();
Function: get/set the end position of the repeat in this sequence
Returns : A scalar representing the base index of the end of the
repeat in this Microsatellite. The first base in the sequence
is base 1.
Args : A scalar representing a value, the string "set", or no
argument (see Notes).
Notes : If you do not provide an argument to this method, the current
end position of the repeat in this Microsatellite will be
returned (a scalar).
If you provide the string "set" to this method it will set the
end position based on the start position, the length of the
motif, and the nuimber of repeats.
If you specify a value the current end position of the repeat
will be set to that value. This is a really bad idea. Don't do
it.
=cut
#'
sub repeat_end_position {
my ($self,$caller) = @_;
if( defined $caller ) {
if ($caller eq "set") {
$self->{'_repeat_end_position'} =
$self->{'_repeat_start_position'} +
(length($self->motif()) * $self->repeats());
}
elsif ($caller) {
$self->{'_repeat_end_position'} = $caller;
}
}
return $self->{'_repeat_end_position'};
}
=head2 equals
Title : equals
Usage : if( $mappable->equals($mapable2)) ...
Function: Test if a position is equal to another position
Returns : boolean
Args : Bio::Map::MappableI
=cut
sub equals {
my ($self,@args) = @_;
$self->warn("equals is not yet implemented in ".
ref($self)." yet. Check back real soon!");
}
=head2 less_than
Title : less_than
Usage : if( $mappable->less_than($m2) ) ...
Function: Tests if a position is less than another position
Returns : boolean
Args : Bio::Map::MappableI
=cut
sub less_than {
my ($self,@args) = @_;
$self->warn("less_then is not yet implemented in ".
ref($self)." yet. Check back real soon!");
}
=head2 greater_than
Title : greater_than
Usage : if( $mappable->greater_than($m2) ) ...
Function: Tests if position is greater than another position
Returns : boolean
Args : Bio::Map::MappableI
=cut
sub greater_than {
my ($self,@args) = @_;
$self->warn("greater_then is not yet implemented in ".
ref($self)." yet. Check back real soon!");
}
=head2 get_leading_flank()
Title : get_leading_flank()
Usage : $leading_sequence = $o_usat->get_leading_flank();
Returns : A scalar representing the sequence before the repeats in this
Microsatellite.
Args : None.
=cut
sub get_leading_flank {
my $self = shift;
return substr $self->sequence(),0,$self->repeat_start_position-1;
}
=head2 get_trailing_flank()
Title : get_trailing_flank()
Usage : $trailing_flank = $o_usat->get_trailing_flank();
Returns : A scalar representing the sequence after the repeats in this
Microsatellite.
Args : None.
=cut
sub get_trailing_flank {
my $self = shift;
return substr $self->sequence(),$self->repeat_end_position()-1;
}
1;
]]>