Raw content of Bio::Seq::PrimedSeq
<![CDATA[# BioPerl module for Bio::PrimedSeq
#
# Cared for by Chad Matsalla <bioinformatics1@dieselwurks.com>
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 Bio::Seq::PrimedSeq
Bio::Seq::PrimedSeq - A representation of a sequence and two primers flanking a
target region for amplification
=head1 SYNOPSIS
# create a sequence
my $sequence = "ctagctagctagctagctagctagctagctgatcgtagctagctagct";
# create left and right primer seqfeatures
# unfortunately, I haven't created constructors for these yet.
my $left = Bio::SeqFeature::Primer();
my $right = Bio::SeqFeature::Primer();
# now create the PrimedSeq
$primedseq = new Bio::Seq::PrimedSeq(
-seq => $sequence,
-display_id => "chads_fantastic_sequence",
-LEFT_PRIMER => $left,
-RIGHT_PRIMER => $right,
-TARGET => '513,26'
-PRIMER_PRODUCT_SIZE_RANGE => '100-500'
-PRIMER_FILE_FLAG => '0'
-PRIMER_LIBERAL_BASE => '1'
-PRIMER_NUM_RETURN => '1'
-PRIMER_FIRST_BASE_INDEX => '1'
-PRIMER_EXPLAIN_FLAG => '1'
-PRIMER_PRODUCT_SIZE => '185'
);
# get the amplified region
my $amplified_sequence = $primed_seq->get_amplified_sequence();
=head1 DESCRIPTION
This module is a slightly glorified capsule containg a primed seqBuence. It was
created to address the fact that a primer is more the a seqfeature and there
need to be ways to represent the primer-sequence complex and the behaviors and
attributes that are associated with the complex.
=head1 FEEDBACK
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bio.perl.org/MailList.html - About the mailing lists
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
bioperl-bugs@bio.perl.org
http://bugzilla.bioperl.org/
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Seq::PrimedSeq;
use vars qw(@ISA);
use strict;
use Bio::RangeI;
@ISA = qw(Bio::Seq);
=head2 new
Title : new()
Usage : $primed_sequence = new Bio::SeqFeature::Primer( -seq => $sequence,
-left_primer => $left_primer,
-right_primer => $right_primer);
Function: A constructor for an object representing a primed sequence
Returns : A Bio::Seq::PrimedSeq object
Args :
-seq => a Bio::Seq object
-left_primer => a Bio::SeqFeature::Primer object
-right_primer => a Bio::SeqFeature::Primer object
Many other parameters can be included including all of the output
parameters from the primer3 program.
Developer Notes: This is incomplete and doesn't work. As of ISMB2002 I am working on it.
=cut
sub new {
my($class,@args) = @_;
my %arguments = @args;
my $self = $class->SUPER::new(@args);
# these are the absolute minimum components required to make
# a primedseq
my $newkey;
foreach my $key (sort keys %arguments) {
($newkey = $key) =~ s/-//;
$self->{$newkey} = $arguments{$key};
push @{$self->{arguments}},$newkey;
}
# and now the insurance- make sure that things are ok
if (!$self->{target_sequence} || !$self->{left_primer} || !$self->{right_primer} ) {
$self->throw("You must provide a target_sequence, left_primer, and right_primer to create this object.");
}
if (ref($self->{target_sequence}) ne "Bio::Seq") {
$self->throw("The target_sequence must be a Bio::Seq to create this object.");
}
if (ref($self->{left_primer}) ne "Bio::SeqFeature::Primer" || ref($self->{right_primer}) ne "Bio::SeqFeature::Primer") {
$self->throw("You must provide a left_primer and right_primer, both as Bio::SeqFeature::Primer to create this object.");
}
return $self;
}
=head2 get_left_primer
Title : get_left_primer();
Usage : $left_primer = $primedseq->get_left_primer();
Function: A getter for the left primer in thie PrimedSeq object.
Returns : A Bio::SeqFeature::Primer object
Args : None.
=cut
sub get_left_primer() {
my $self = shift;
}
=head2 Bio::RangeI methods
List of interfaces inherited from Bio::RangeI (see L<Bio::RangeI>
for details).
=head2 start
Title : start
Usage : $start = $feat->start
Function: Returns the start coordinate of the feature
Returns : integer
Args : none
Developer Notes:
This is entirely dependent on the sequence to which this primer is attached!
I think that there could be trouble if one takes this primer from sequence 1
and naively place it on sequence 2 without updating this
** This is incomplete at this time.
=cut
sub start() {
my $self = shift;
}
=head2 end
Title : end
Usage : $end = $feat->end
Function: Returns the end coordinate of the feature
Returns : integer
Args : none
Developer Notes:
** This is incomplete at this time.
=cut
sub end() {
my $self = shift;
}
=head2 strand
Title : strand
Usage : $strand = $feat->strand()
Function: Returns strand information, being 1,-1 or 0
Returns : -1,1 or 0
Args : none
Developer Notes:
** This is incomplete at this time.
=cut
sub strand() {
my $self = shift;
}
=head2 SeqFeatureI specific methods
New method interfaces.
=head2 sub_SeqFeature
Title : sub_SeqFeature
Usage : @feats = $feat->sub_SeqFeature();
Function: Returns an array of sub Sequence Features
Returns : An array
Args : none
=cut
sub sub_SeqFeature{
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 display_id
Title : display_id
Usage : $name = $feat->display_id()
Function: Returns the human-readable ID of the
feature for displays.
Returns : a string
Args : none
=cut
sub display_id {
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 primary_tag
Title : primary_tag
Usage : $tag = $feat->primary_tag()
Function: Returns the primary tag for a feature,
eg 'exon'
Returns : a string
Args : none
=cut
sub primary_tag{
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 source_tag
Title : source_tag
Usage : $tag = $feat->source_tag()
Function: Returns the source tag for a feature,
eg, 'genscan'
Returns : a string
Args : none
=cut
sub source_tag{
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 has_tag
Title : has_tag
Usage : $tag_exists = $self->has_tag('some_tag')
Function:
Returns : TRUE if the specified tag exists, and FALSE otherwise
Args :
=cut
sub has_tag{
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 each_tag_value
Title : each_tag_value
Usage : @values = $self->each_tag_value('some_tag')
Function:
Returns : An array comprising the values of the specified tag.
Args :
=cut
sub each_tag_value {
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 all_tags
Title : all_tags
Usage : @tags = $feat->all_tags()
Function: gives all tags for this feature
Returns : an array of strings
Args : none
=cut
sub all_tags{
my ($self,@args) = @_;
$self->throw_not_implemented();
}
=head2 gff_string
Title : gff_string
Usage : $str = $feat->gff_string;
$str = $feat->gff_string($gff_formatter);
Function: Provides the feature information in GFF format.
The implementation provided here returns GFF2 by default. If you
want a different version, supply an object implementing a method
gff_string() accepting a SeqFeatureI object as argument. E.g., to
obtain GFF1 format, do the following:
my $gffio = Bio::Tools::GFF->new(-gff_version => 1);
$gff1str = $feat->gff_string($gff1io);
Returns : A string
Args : Optionally, an object implementing gff_string().
=cut
sub gff_string{
my ($self,$formatter) = @_;
$formatter = $self->_static_gff_formatter unless $formatter;
return $formatter->gff_string($self);
}
my $static_gff_formatter = undef;
=head2 _static_gff_formatter
Title : _static_gff_formatter
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _static_gff_formatter{
my ($self,@args) = @_;
if( !defined $static_gff_formatter ) {
$static_gff_formatter = Bio::Tools::GFF->new('-gff_version' => 2);
}
return $static_gff_formatter;
}
=head1 RangeI methods
These methods are inherited from RangeI and can be used
directly from a SeqFeatureI interface. Remember that a
SeqFeature is-a RangeI, and so wherever you see RangeI you
can use a feature ($r in the below documentation).
=head2 overlaps
Title : overlaps
Usage : if($feat->overlaps($r)) { do stuff }
if($feat->overlaps(200)) { do stuff }
Function: tests if $feat overlaps $r
Args : a RangeI to test for overlap with, or a point
Returns : true if the Range overlaps with the feature, false otherwise
=head2 contains
Title : contains
Usage : if($feat->contains($r) { do stuff }
Function: tests whether $feat totally contains $r
Args : a RangeI to test for being contained
Returns : true if the argument is totaly contained within this range
=head2 equals
Title : equals
Usage : if($feat->equals($r))
Function: test whether $feat has the same start, end, strand as $r
Args : a RangeI to test for equality
Returns : true if they are describing the same range
=head1 Geometrical methods
These methods do things to the geometry of ranges, and return
triplets (start, stop, strand) from which new ranges could be built.
=head2 intersection
Title : intersection
Usage : ($start, $stop, $strand) = $feat->intersection($r)
Function: gives the range that is contained by both ranges
Args : a RangeI to compare this one to
Returns : nothing if they do not overlap, or the range that they do overlap
=head2 union
Title : union
Usage : ($start, $stop, $strand) = $feat->union($r);
: ($start, $stop, $strand) = Bio::RangeI->union(@ranges);
Function: finds the minimal range that contains all of the ranges
Args : a range or list of ranges to find the union of
Returns : the range containing all of the ranges
=cut
=head2 location
Title : location
Usage : my $location = $seqfeature->location()
Function: returns a location object suitable for identifying location
of feature on sequence or parent feature
Returns : Bio::LocationI object
Args : none
=cut
sub location {
my ($self) = @_;
$self->throw_not_implemented();
}
1;
]]>