Raw content of Bio::Seq::PrimedSeq # BioPerl module for Bio::PrimedSeq # # Cared for by Chad Matsalla <bioinformatics1@dieselwurks.com> # # Copyright Chad Matsalla # # You may distribute this module under the same terms as perl itself # POD documentation - main docs before the code =head1 Bio::Seq::PrimedSeq Bio::Seq::PrimedSeq - A representation of a sequence and two primers flanking a target region for amplification =head1 SYNOPSIS # create a sequence my $sequence = "ctagctagctagctagctagctagctagctgatcgtagctagctagct"; # create left and right primer seqfeatures # unfortunately, I haven't created constructors for these yet. my $left = Bio::SeqFeature::Primer(); my $right = Bio::SeqFeature::Primer(); # now create the PrimedSeq $primedseq = new Bio::Seq::PrimedSeq( -seq => $sequence, -display_id => "chads_fantastic_sequence", -LEFT_PRIMER => $left, -RIGHT_PRIMER => $right, -TARGET => '513,26' -PRIMER_PRODUCT_SIZE_RANGE => '100-500' -PRIMER_FILE_FLAG => '0' -PRIMER_LIBERAL_BASE => '1' -PRIMER_NUM_RETURN => '1' -PRIMER_FIRST_BASE_INDEX => '1' -PRIMER_EXPLAIN_FLAG => '1' -PRIMER_PRODUCT_SIZE => '185' ); # get the amplified region my $amplified_sequence = $primed_seq->get_amplified_sequence(); =head1 DESCRIPTION This module is a slightly glorified capsule containg a primed seqBuence. It was created to address the fact that a primer is more the a seqfeature and there need to be ways to represent the primer-sequence complex and the behaviors and attributes that are associated with the complex. =head1 FEEDBACK User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. bioperl-l@bioperl.org - General discussion http://bio.perl.org/MailList.html - About the mailing lists =head2 Reporting Bugs Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web: bioperl-bugs@bio.perl.org http://bugzilla.bioperl.org/ =head1 APPENDIX The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ =cut # Let the code begin... package Bio::Seq::PrimedSeq; use vars qw(@ISA); use strict; use Bio::RangeI; @ISA = qw(Bio::Seq); =head2 new Title : new() Usage : $primed_sequence = new Bio::SeqFeature::Primer( -seq => $sequence, -left_primer => $left_primer, -right_primer => $right_primer); Function: A constructor for an object representing a primed sequence Returns : A Bio::Seq::PrimedSeq object Args : -seq => a Bio::Seq object -left_primer => a Bio::SeqFeature::Primer object -right_primer => a Bio::SeqFeature::Primer object Many other parameters can be included including all of the output parameters from the primer3 program. Developer Notes: This is incomplete and doesn't work. As of ISMB2002 I am working on it. =cut sub new { my($class,@args) = @_; my %arguments = @args; my $self = $class->SUPER::new(@args); # these are the absolute minimum components required to make # a primedseq my $newkey; foreach my $key (sort keys %arguments) { ($newkey = $key) =~ s/-//; $self->{$newkey} = $arguments{$key}; push @{$self->{arguments}},$newkey; } # and now the insurance- make sure that things are ok if (!$self->{target_sequence} || !$self->{left_primer} || !$self->{right_primer} ) { $self->throw("You must provide a target_sequence, left_primer, and right_primer to create this object."); } if (ref($self->{target_sequence}) ne "Bio::Seq") { $self->throw("The target_sequence must be a Bio::Seq to create this object."); } if (ref($self->{left_primer}) ne "Bio::SeqFeature::Primer" || ref($self->{right_primer}) ne "Bio::SeqFeature::Primer") { $self->throw("You must provide a left_primer and right_primer, both as Bio::SeqFeature::Primer to create this object."); } return $self; } =head2 get_left_primer Title : get_left_primer(); Usage : $left_primer = $primedseq->get_left_primer(); Function: A getter for the left primer in thie PrimedSeq object. Returns : A Bio::SeqFeature::Primer object Args : None. =cut sub get_left_primer() { my $self = shift; } =head2 Bio::RangeI methods List of interfaces inherited from Bio::RangeI (see L<Bio::RangeI> for details). =head2 start Title : start Usage : $start = $feat->start Function: Returns the start coordinate of the feature Returns : integer Args : none Developer Notes: This is entirely dependent on the sequence to which this primer is attached! I think that there could be trouble if one takes this primer from sequence 1 and naively place it on sequence 2 without updating this ** This is incomplete at this time. =cut sub start() { my $self = shift; } =head2 end Title : end Usage : $end = $feat->end Function: Returns the end coordinate of the feature Returns : integer Args : none Developer Notes: ** This is incomplete at this time. =cut sub end() { my $self = shift; } =head2 strand Title : strand Usage : $strand = $feat->strand() Function: Returns strand information, being 1,-1 or 0 Returns : -1,1 or 0 Args : none Developer Notes: ** This is incomplete at this time. =cut sub strand() { my $self = shift; } =head2 SeqFeatureI specific methods New method interfaces. =head2 sub_SeqFeature Title : sub_SeqFeature Usage : @feats = $feat->sub_SeqFeature(); Function: Returns an array of sub Sequence Features Returns : An array Args : none =cut sub sub_SeqFeature{ my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 display_id Title : display_id Usage : $name = $feat->display_id() Function: Returns the human-readable ID of the feature for displays. Returns : a string Args : none =cut sub display_id { my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 primary_tag Title : primary_tag Usage : $tag = $feat->primary_tag() Function: Returns the primary tag for a feature, eg 'exon' Returns : a string Args : none =cut sub primary_tag{ my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 source_tag Title : source_tag Usage : $tag = $feat->source_tag() Function: Returns the source tag for a feature, eg, 'genscan' Returns : a string Args : none =cut sub source_tag{ my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 has_tag Title : has_tag Usage : $tag_exists = $self->has_tag('some_tag') Function: Returns : TRUE if the specified tag exists, and FALSE otherwise Args : =cut sub has_tag{ my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 each_tag_value Title : each_tag_value Usage : @values = $self->each_tag_value('some_tag') Function: Returns : An array comprising the values of the specified tag. Args : =cut sub each_tag_value { my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 all_tags Title : all_tags Usage : @tags = $feat->all_tags() Function: gives all tags for this feature Returns : an array of strings Args : none =cut sub all_tags{ my ($self,@args) = @_; $self->throw_not_implemented(); } =head2 gff_string Title : gff_string Usage : $str = $feat->gff_string; $str = $feat->gff_string($gff_formatter); Function: Provides the feature information in GFF format. The implementation provided here returns GFF2 by default. If you want a different version, supply an object implementing a method gff_string() accepting a SeqFeatureI object as argument. E.g., to obtain GFF1 format, do the following: my $gffio = Bio::Tools::GFF->new(-gff_version => 1); $gff1str = $feat->gff_string($gff1io); Returns : A string Args : Optionally, an object implementing gff_string(). =cut sub gff_string{ my ($self,$formatter) = @_; $formatter = $self->_static_gff_formatter unless $formatter; return $formatter->gff_string($self); } my $static_gff_formatter = undef; =head2 _static_gff_formatter Title : _static_gff_formatter Usage : Function: Example : Returns : Args : =cut sub _static_gff_formatter{ my ($self,@args) = @_; if( !defined $static_gff_formatter ) { $static_gff_formatter = Bio::Tools::GFF->new('-gff_version' => 2); } return $static_gff_formatter; } =head1 RangeI methods These methods are inherited from RangeI and can be used directly from a SeqFeatureI interface. Remember that a SeqFeature is-a RangeI, and so wherever you see RangeI you can use a feature ($r in the below documentation). =head2 overlaps Title : overlaps Usage : if($feat->overlaps($r)) { do stuff } if($feat->overlaps(200)) { do stuff } Function: tests if $feat overlaps $r Args : a RangeI to test for overlap with, or a point Returns : true if the Range overlaps with the feature, false otherwise =head2 contains Title : contains Usage : if($feat->contains($r) { do stuff } Function: tests whether $feat totally contains $r Args : a RangeI to test for being contained Returns : true if the argument is totaly contained within this range =head2 equals Title : equals Usage : if($feat->equals($r)) Function: test whether $feat has the same start, end, strand as $r Args : a RangeI to test for equality Returns : true if they are describing the same range =head1 Geometrical methods These methods do things to the geometry of ranges, and return triplets (start, stop, strand) from which new ranges could be built. =head2 intersection Title : intersection Usage : ($start, $stop, $strand) = $feat->intersection($r) Function: gives the range that is contained by both ranges Args : a RangeI to compare this one to Returns : nothing if they do not overlap, or the range that they do overlap =head2 union Title : union Usage : ($start, $stop, $strand) = $feat->union($r); : ($start, $stop, $strand) = Bio::RangeI->union(@ranges); Function: finds the minimal range that contains all of the ranges Args : a range or list of ranges to find the union of Returns : the range containing all of the ranges =cut =head2 location Title : location Usage : my $location = $seqfeature->location() Function: returns a location object suitable for identifying location of feature on sequence or parent feature Returns : Bio::LocationI object Args : none =cut sub location { my ($self) = @_; $self->throw_not_implemented(); } 1;