Raw content of Bio::Tools::Run::StandAloneBlast
# $Id: StandAloneBlast.pm,v 1.23.2.3 2003/03/29 20:18:51 jason Exp $
#
# BioPerl module for Bio::Tools::StandAloneBlast
#
# Cared for by Peter Schattner
#
# Copyright Peter Schattner
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Tools::Run::StandAloneBlast - Object for the local execution of the
NCBI Blast program suite (blastall, blastpgp, bl2seq)
=head1 SYNOPSIS
Local-blast "factory object" creation and blast-parameter initialization:
@params = ('database' => 'swissprot','outfile' => 'blast1.out',
'_READMETHOD' => 'Blast');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
Blast a sequence against a database:
$str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta' );
$input = $str->next_seq();
$input2 = $str->next_seq();
$blast_report = $factory->blastall($input);
Run an iterated Blast (psiblast) of a sequence against a database:
$factory->j(3); # 'j' is blast parameter for # of iterations
$factory->outfile('psiblast1.out');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
$blast_report = $factory->blastpgp($input);
Use blast to align 2 sequences against each other:
$factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out');
$factory->bl2seq($input, $input2);
Various additional options and input formats are available. See the
DESCRIPTION section for details.
=head1 DESCRIPTION
This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast: - a
Bioperl object for running the NCBI standAlone BLAST package. Blast,
itself, is a large & complex program - for more information regarding
BLAST, please see the BLAST documentation which accompanies the BLAST
distribution. BLAST is available from ftp://ncbi.nlm.nih.gov/blast/.
(A source of confusion in documenting a BLAST interface is that the
term "program" is used in - at least - three different ways in the
BLAST documentation. In this DESCRIPTION, "program" will refer to the
BLAST routine set by BLAST's C<-p> parameter that can be set to blastn,
blastp, tblastx etc. We will use the term Blast "executable" to refer
to the various different executable files that may be called - ie
blastall, blastpgp or bl2seq. In addition, there are several BLAST
capabilities (which are also referred to as "programs") and are
implemented by using specific combinations of BLAST executables,
programs and parameters. They will be referred by their specific
names - eg PSIBLAST and PHIBLAST. )
StandAloneBlast has been tested so far only under Linux. I expect
that it should also work under other Unix systems. However, since the
module is implemented using (unix) system calls, modification may be
necessary before StandAloneBlast would work under non-Unix
operating systems (eg Windows, MacOS). Before running
StandAloneBlast it is necessary: to install BLAST on your system,
to edit set the environmental variable $BLASTDIR or your $PATH
variable to point to the BLAST directory, and to ensure that users
have execute privileges for the BLAST program. If the databases
which will be searched by BLAST are located in the data subdirectory
of the blast program directory (the default installation location),
StandAloneBlast will find them; however, if the database files are
located in any other location, environmental variable $BLASTDATADIR
will need to be set to point to that directory.
The use of the StandAloneBlast module is as follows: Initially, a
local blast "factory object" is created. The constructor may be passed
an optional array of (non-default) parameters to be used by the
factory, eg:
@params = ('program' => 'blastn', 'database' => 'ecoli.nt');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
Any parameters not explicitly set will remain as the defaults of the
BLAST executable. Note each BLAST executable has somewhat different
parameters and options. See the BLAST Documentation for a description
or run the BLAST executable from the command line followed solely with
a "-" to see a list of options and default values for that executable;
eg Eblastall -.
BLAST parameters can be changed and/or examined at any time after the
factory has been created. The program checks that any
parameter/switch being set/read is valid. Except where specifically
noted, StandAloneBlast uses the same single-letter, case-sensitive
parameter names as the actual blast program. Currently no checks are
included to verify that parameters are of the proper type (eg string
or numeric) or that their values are within the proper range.
As an example, to change the value of the Blast parameter 'e' ('e' is
the parameter for expectation-value cutoff)
$expectvalue = 0.01;
$factory->e($expectvalue);
Note that for improved script readibility one can modify the name of
the BLAST parameters as desired as long as the initial letter (and
case) of the parameter are preserved, eg
$factory-Eexpectvalue($expectvalue); Unfortunately, some of the BLAST
parameters are not the single letter one might expect (eg "iteration
round" in blastpgp is 'j'). Again one can check by using (eg)
> blastpgp - .
Once the factory has been created and the appropriate parameters set,
one can call one of the supported blast executables. The input
sequence(s) to these executables may be fasta file(s) as described in
the BLAST documentation.
$inputfilename = 't/testquery.fa';
$blast_report = $factory->blastall($inputfilename);
In addition, sequence input may be in the form of either a Bio::Seq
object or or an array of Bio::Seq objects, eg
$input = Bio::Seq->new(-id=>"test query",-seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
For blastall and non-psiblast blastpgp runs, report object is either a
BPlite.pm or Bio::SearchIO object, selected by the user with the
parameter _READMETHOD. (The leading underscore is needed to
distinguish this option from options which are passed to the BLAST
executable.) The default parser is Bio::SearchIO::blast. For
(multiple iteration) psiblast and bl2seq runs the report is
automatically parsed by the BPpsilite.pm and BPbl2seq.pm parsers
respectively, since neither Blast.pm nor BPlite can parse these
reports. In any case, the "raw" blast report is also available. The
filename is set by the in the 'outfile' parameter and has the default
value of "blastreport.out".
For psiblast execution in BLAST's "jumpstart" mode, the program must
be passed (in addition to the query sequence itself) an alignment
containing the query sequence (in the form of a SimpleAlign object) as
well as a "mask" specifying at what residues position-specific scoring
matrices (PSSMs) are to used and at what residues default scoring
matrices (eg BLOSUM) are to be used. See psiblast documentation for
more details. The mask itself is a string of 0's and 1's which is the
same length as each sequence in the alignment and has a "1" at
locations where (PSSMs) are to be used and a "0" at all other
locations. So for example:
$str = Bio::AlignIO->new(-file=> "cysprot.msf", '-format' => 'msf' );
$aln = $str->next_aln();
$len = $aln->length_aln();
$mask = '1' x $len; # simple case where PSSM's to be used at all residues
$report = $factory->blastpgp("cysprot1.fa", $aln, $mask);
For bl2seq execution, StandAloneBlast.pm can be combined with
AlignIO.pm to directly produce a SimpleAlign object from the alignment
of the two sequences produced by bl2seq as in:
#Get 2 sequences
$str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta', );
my $seq3 = $str->next_seq();
my $seq4 = $str->next_seq();
# Run bl2seq on them
$factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out');
my $bl2seq_report = $factory->bl2seq($seq3, $seq4);
# Use AlignIO.pm to create a SimpleAlign object from the bl2seq report
$str = Bio::AlignIO->new(-file=> 'bl2seq.out','-format' => 'bl2seq');
$aln = $str->next_aln();
For more examples of syntax and use of Blast.pm, the user is
encouraged to run the scripts standaloneblast.pl in the bioperl
/examples directory and StandAloneBlast.t in the bioperl /t directory.
Note: There is a similar (but older) perl object interface offered by
nhgri. The nhgri module only supports blastall and does not support
blastpgp, psiblast, phiblast, bl2seq etc. This module can be found at
http://genome.nhgri.nih.gov/blastall/.
=head1 DEVELOPERS NOTES
B
Note: This module is still under development. If you would like that a
specific BLAST feature be added to this perl interface, let me know.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bio.perl.org/MailList.html - About the mailing lists
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
bioperl-bugs@bio.perl.org
http://bio.perl.org/bioperl-bugs/
=head1 AUTHOR - Peter Schattner
Email schattner@alum.mit.edu
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
package Bio::Tools::Run::StandAloneBlast;
use vars qw($AUTOLOAD @ISA $PROGRAMDIR $DATADIR
@BLASTALL_PARAMS @BLASTPGP_PARAMS
@BL2SEQ_PARAMS @OTHER_PARAMS %OK_FIELD
);
use strict;
use Bio::Root::Root;
use Bio::Root::IO;
use Bio::Seq;
use Bio::SeqIO;
use Bio::Tools::BPbl2seq;
use Bio::Tools::BPpsilite;
use Bio::SearchIO;
use Bio::Tools::Run::WrapperBase;
use Bio::Factory::ApplicationFactoryI;
BEGIN {
@BLASTALL_PARAMS = qw( p d i e m o F G E X I q r v b f g Q
D a O J M W z K L Y S T l U y Z);
@BLASTPGP_PARAMS = qw(d i A f e m o y P F G E X N g S H a I h c
j J Z O M v b C R W z K L Y p k T Q B l U);
@BL2SEQ_PARAMS = qw(i j p g o d a G E X W M q r F e S T m);
# Non BLAST parameters start with underscore to differentiate them
# from BLAST parameters
@OTHER_PARAMS = qw(_READMETHOD);
# _READMETHOD = 'BPlite' (default) or 'Blast'
# my @other_switches = qw(QUIET);
# Authorize attribute fields
foreach my $attr (@BLASTALL_PARAMS, @BLASTPGP_PARAMS,
@BL2SEQ_PARAMS, @OTHER_PARAMS )
{ $OK_FIELD{$attr}++; }
# You will need to enable Blast to find the Blast program. This can be done
# in (at least) two different ways:
# 1. define an environmental variable blastDIR:
# export BLASTDIR=/home/peter/blast or
# 2. include a definition of an environmental variable BLASTDIR in every script that will
# use StandAloneBlast.pm.
# BEGIN {$ENV{BLASTDIR} = '/home/peter/blast/'; }
$PROGRAMDIR = $ENV{'BLASTDIR'} || '';
# If local BLAST databases are not stored in the standard
# /data directory, the variable BLASTDATADIR will need to be set explicitly
$DATADIR = $ENV{'BLASTDATADIR'} || $ENV{'BLASTDB'} || '';
}
@ISA = qw(Bio::Root::Root
Bio::Tools::Run::WrapperBase
Bio::Factory::ApplicationFactoryI);
=head1 BLAST parameters
Essentially all BLAST parameter can be set via StandAloneBlast.pm.
Some of the most commonly used parameters are listed below. All
parameters have defaults and are optional (I think.) For a complete
listing of settable parameters, run the relevant executable BLAST
program with the option "-" as in blastall -
=head2 Blastall
-p Program Name [String]
Input should be one of "blastp", "blastn", "blastx",
"tblastn", or "tblastx".
-d Database [String] default = nr
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "nr est"
-i Query File [File In] Set by StandAloneBlast.pm from script.
default = stdin. The query should be in FASTA format. If multiple FASTA entries are in the input
file, all queries will be searched.
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
=head2 Blastpgp (including Psiblast)
-j is the maximum number of rounds (default 1; i.e., regular BLAST)
-h is the e-value threshold for including sequences in the
score matrix model (default 0.001)
-c is the "constant" used in the pseudocount formula specified in the paper (default 10)
-B Multiple alignment file for PSI-BLAST "jump start mode" Optional
-Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional
=head2 Bl2seq
-i First sequence [File In]
-j Second sequence [File In]
-p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
default = blastp
-o alignment output file [File Out] default = stdout
-e Expectation value (E) [Real] default = 10.0
-S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
=cut
sub new {
my ($caller, @args) = @_;
# chained new
my $self = $caller->SUPER::new(@args);
# to facilitiate tempfile cleanup
my ($tfh,$tempfile) = $self->io->tempfile();
close($tfh); # we don't want the filehandle, just a temporary name
$self->outfile($tempfile);
$self->_READMETHOD('Blast');
while (@args) {
my $attr = shift @args;
my $value = shift @args;
next if( $attr eq '-verbose');
# the workaround to deal with initializing
$attr = 'p' if $attr =~ /^\s*program\s*$/;
$self->$attr($value);
}
return $self;
}
sub AUTOLOAD {
my $self = shift;
my $attr = $AUTOLOAD;
$attr =~ s/.*:://;
my $attr_letter = substr($attr, 0, 1) ;
# actual key is first letter of $attr unless first attribute
# letter is underscore (as in _READMETHOD), the $attr is a BLAST
# parameter and should be truncated to its first letter only
$attr = ($attr_letter eq '_') ? $attr : $attr_letter;
$self->throw("Unallowed parameter: $attr !") unless $OK_FIELD{$attr};
# $self->throw("Unallowed parameter: $attr !") unless $ok_field{$attr_letter};
$self->{$attr_letter} = shift if @_;
return $self->{$attr_letter};
}
=head1 Methods
=head2 executable
Title : executable
Usage : my $exe = $blastfactory->executable('blastall');
Function: Finds the full path to the 'codeml' executable
Returns : string representing the full path to the exe
Args : [optional] name of executable to set path to
[optional] boolean flag whether or not warn when exe is not found
=cut
sub executable {
my ($self, $exename, $exe,$warn) = @_;
$exename = 'blastall' unless defined $exename;
if( defined $exe && -x $exe ) {
$self->{'_pathtoexe'}->{$exename} = $exe;
}
unless( defined $self->{'_pathtoexe'}->{$exename} ) {
my $f = $self->program_path($exename);
$exe = $self->{'_pathtoexe'}->{$exename} = $f if(-e $f && -x $f );
# This is how I meant to split up these conditionals --jason
# if exe is null we will execute this (handle the case where
# PROGRAMDIR pointed to something invalid)
unless( $exe ) { # we didn't find it in that last conditional
if( ($exe = $self->io->exists_exe($exename)) && -x $exe ) {
$self->{'_pathtoexe'}->{$exename} = $exe;
} else {
$self->warn("Cannot find executable for $exename") if $warn;
$self->{'_pathtoexe'}->{$exename} = undef;
}
}
}
return $self->{'_pathtoexe'}->{$exename};
}
=head2 program_path
Title : program_path
Usage : my $path = $factory->program_path();
Function: Builds path for executable
Returns : string representing the full path to the exe
Args : none
=cut
sub program_path {
my ($self,$program_name) = @_;
my @path;
push @path, $self->program_dir if $self->program_dir;
push @path, $program_name .($^O =~ /mswin/i ?'.exe':'');
return Bio::Root::IO->catfile(@path);
}
=head2 program_dir
Title : program_dir
Usage : my $dir = $factory->program_dir();
Function: Abstract get method for dir of program. To be implemented
by wrapper.
Returns : string representing program directory
Args : none
=cut
sub program_dir {
$PROGRAMDIR;
}
sub program {
my $self = shift;
if( wantarray ) {
return ($self->executable, $self->p());
} else {
return $self->executable(@_);
}
}
=head2 blastall
Title : blastall
Usage : $blast_report = $factory->blastall('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
or
$seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->blastall(\@seq_array);
Returns : Reference to a Blast object or BPlite object
containing the blast report.
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
=cut
sub blastall {
my ($self,$input1) = @_;
$self->io->_io_cleanup();
my $executable = 'blastall';
my $input2;
# Create input file pointer
my $infilename1 = $self->_setinput($executable, $input1);
if (! $infilename1) {$self->throw(" $input1 ($infilename1) not Bio::Seq object or array of Bio::Seq objects or file name!");}
$self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastall)
my $blast_report = &_generic_local_blast($self, $executable,
$input1, $input2);
}
=head2 blastpgp
Title : blastpgp
Usage : $blast_report = $factory-> blastpgp('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->blastpgp ($input);
or
$seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects
$blast_report = $factory-> blastpgp(\@seq_array);
Returns : Reference to a Blast object or BPlite object containing
the blast report.
Args : Name of a file or Bio::Seq object. In psiblast jumpstart
mode two additional arguments are required: a SimpleAlign
object one of whose elements is the query and a "mask" to
determine how BLAST should select scoring matrices see
DESCRIPTION above for more details.
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
Returns : Reference to either a BPlite.pm, Blast.pm or BPpsilite.pm
object containing the blast report.
=cut
sub blastpgp {
my $self = shift;
my $executable = 'blastpgp';
my $input1 = shift;
my $input2 = shift;
my $mask = shift; # used by blastpgp's -B option to specify which residues are position aligned
my ($infilename1, $infilename2 ) = $self->_setinput($executable,
$input1, $input2,
$mask);
if (!$infilename1) {$self->throw(" $input1 not Bio::Seq object or array of Bio::Seq objects or file name!");}
$self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastpgp)
if ($input2) {
unless ($infilename2) {$self->throw("$input2 not SimpleAlign Object in pre-aligned psiblast\n");}
$self->B($infilename2); # set file name of partial alignment to inputfilename2 (-B param of blastpgp)
}
my $blast_report = &_generic_local_blast($self, $executable, $input1, $input2);
}
=head2 bl2seq
Title : bl2seq
Usage : $factory-> blastpgp('t/seq1.fa', 't/seq2.fa');
or
$input1 = Bio::Seq->new(-id=>"test query1",
-seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$input2 = Bio::Seq->new(-id=>"test query2",
-seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
$blast_report = $factory->bl2seq ($input1, $input2);
Returns : Reference to a BPbl2seq object containing the blast report.
Args : Names of 2 files or 2 Bio::Seq objects containing the
sequences to be aligned by bl2seq.
Throws an exception if argument is not either a pair of
strings (eg filenames) or references to Bio::Seq objects.
If arguments are strings, throws exception if files
corresponding to string names can not be found.
=cut
sub bl2seq {
my $self = shift;
my $executable = 'bl2seq';
my $input1 = shift;
my $input2 = shift;
# Create input file pointer
my ($infilename1, $infilename2 ) = $self->_setinput($executable,
$input1, $input2);
if (!$infilename1){$self->throw(" $input1 not Seq Object or file name!");}
if (!$infilename2){$self->throw("$input2 not Seq Object or file name!");}
$self->i($infilename1); # set file name of first sequence to
# be aligned to inputfilename1
# (-i param of bl2seq)
$self->j($infilename2); # set file name of first sequence to
# be aligned to inputfilename2
# (-j param of bl2seq)
my $blast_report = &_generic_local_blast($self, $executable);
}
#################################################
=head2 _generic_local_blast
Title : _generic_local_blast
Usage : internal function not called directly
Returns : Blast or BPlite object
Args : Reference to calling object and name of BLAST executable
=cut
sub _generic_local_blast {
my $self = shift;
my $executable = shift;
# Create parameter string to pass to Blast program
my $param_string = $self->_setparams($executable);
# run Blast
my $blast_report = &_runblast($self, $executable, $param_string);
}
=head2 _runblast
Title : _runblast
Usage : Internal function, not to be called directly
Function: makes actual system call to Blast program
Example :
Returns : Report object in the appropriate format (BPlite,
BPpsilite, Blast, or BPbl2seq)
Args : Reference to calling object, name of BLAST executable,
and parameter string for executable
=cut
sub _runblast {
my ($self,$executable,$param_string) = @_;
my ($blast_obj,$exe);
if( ! ($exe = $self->executable($executable)) ) {
$self->warn("cannot find path to $executable");
return undef;
}
my $commandstring = $exe. $param_string;
# next line for debugging
$self->debug( "$commandstring \n");
my $status = system($commandstring);
$self->throw("$executable call crashed: $? $commandstring\n") unless ($status==0) ;
my $outfile = $self->o() ; # get outputfilename
my $signif = $self->e() || 1e-5 ;
# set significance cutoff to set expectation value or default value
# (may want to make this value vary for different executables)
# If running bl2seq or psiblast (blastpgp with multiple iterations),
# the specific parsers for these programs must be used (ie BPbl2seq or
# BPpsilite). Otherwise either the Blast parser or the BPlite
# parsers can be selected.
if ($executable =~ /bl2seq/i) {
if( $self->verbose > 0 ) {
open(OUT, $outfile) || $self->throw("cannot open $outfile");
while() { $self->debug($_)}
close(OUT);
}
# Added program info so BPbl2seq can compute strand info
$blast_obj = Bio::Tools::BPbl2seq->new(-file => $outfile,
-REPORT_TYPE => $self->p );
# $blast_obj = Bio::Tools::BPbl2seq->new(-file => $outfile);
}
elsif ($executable =~ /blastpgp/i && defined $self->j() &&
$self->j() > 1) {
print "using psilite parser\n";
$blast_obj = Bio::Tools::BPpsilite->new(-file => $outfile);
}
elsif ($self->_READMETHOD =~ /^Blast/i ) {
$blast_obj = Bio::SearchIO->new(-file=>$outfile,
-format => 'blast' ) ;
}
elsif ($self->_READMETHOD =~ /^BPlite/i ) {
$blast_obj = Bio::Tools::BPlite->new(-file=>$outfile);
} else {
$self->warn("Unrecognized readmethod ".$self->_READMETHOD. " or executable $executable\n");
}
return $blast_obj;
}
=head2 _setinput
Title : _setinput
Usage : Internal function, not to be called directly
Function: Create input file(s) for Blast executable
Example :
Returns : name of file containing Blast data input
Args : Seq object reference or input file name
=cut
sub _setinput {
my ($self, $executable, $input1, $input2) = @_;
my ($seq, $temp, $infilename1, $infilename2,$fh ) ;
# If $input1 is not a reference it better be the name of a file with
# the sequence/ alignment data...
$self->io->_io_cleanup();
SWITCH: {
unless (ref $input1) {
$infilename1 = (-e $input1) ? $input1 : 0 ;
last SWITCH;
}
# $input may be an array of BioSeq objects...
if (ref($input1) =~ /ARRAY/i ) {
($fh,$infilename1) = $self->io->tempfile();
$temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta');
foreach $seq (@$input1) {
unless ($seq->isa("Bio::PrimarySeqI")) {return 0;}
$temp->write_seq($seq);
}
close $fh;
$fh = undef;
last SWITCH;
}
# $input may be a single BioSeq object...
elsif ($input1->isa("Bio::PrimarySeqI")) {
($fh,$infilename1) = $self->io->tempfile();
# just in case $input1 is taken from an alignment and has spaces (ie
# deletions) indicated within it, we have to remove them - otherwise
# the BLAST programs will be unhappy
my $seq_string = $input1->seq();
$seq_string =~ s/\W+//g; # get rid of spaces in sequence
$input1->seq($seq_string);
$temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta');
$temp->write_seq($input1);
close $fh;
undef $fh;
# $temp->write_seq($input1);
last SWITCH;
}
$infilename1 = 0; # Set error flag if you get here
} # End SWITCH
unless ($input2) { return $infilename1; }
SWITCH2: {
unless (ref $input2) {
$infilename2 = (-e $input2) ? $input2 : 0 ;
last SWITCH2;
}
if ($input2->isa("Bio::PrimarySeqI") && $executable eq 'bl2seq' ) {
($fh,$infilename2) = $self->io->tempfile();
$temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta');
$temp->write_seq($input2);
close $fh;
undef $fh;
last SWITCH2;
}
# Option for using psiblast's pre-alignment "jumpstart" feature
elsif ($input2->isa("Bio::SimpleAlign") &&
$executable eq 'blastpgp' ) {
# a bit of a lie since it won't be a fasta file
($fh,$infilename2) = $self->io->tempfile();
# first we retrieve the "mask" that determines which residues should
# by scored according to their position and which should be scored
# using the non-position-specific matrices
my @mask = split("", shift ); # get mask
# then we have to convert all the residues in every sequence to upper
# case at the positions that we want psiblast to use position specific
# scoring
foreach $seq ( $input2->each_seq() ) {
my @seqstringlist = split("",$seq->seq());
for (my $i = 0; $i < scalar(@mask); $i++) {
unless ( $seqstringlist[$i] =~ /[a-zA-Z]/ ) {next}
$seqstringlist[$i] = $mask[$i] ? uc $seqstringlist[$i]: lc $seqstringlist[$i] ;
}
my $newseqstring = join("", @seqstringlist);
$seq->seq($newseqstring);
}
# Now we need to write out the alignment to a file
# in the "psi format" which psiblast is expecting
$input2->map_chars('\.','-');
$temp = Bio::AlignIO->new(-fh=> $fh, '-format' => 'psi');
$temp->write_aln($input2);
close $fh;
undef $fh;
last SWITCH2;
}
$infilename2 = 0; # Set error flag if you get here
} # End SWITCH2
return ($infilename1, $infilename2);
}
=head2 _setparams
Title : _setparams
Usage : Internal function, not to be called directly
Function: Create parameter inputs for Blast program
Example :
Returns : parameter string to be passed to Blast
Args : Reference to calling object and name of BLAST executable
=cut
sub _setparams {
my ($self,$executable) = @_;
my ($attr, $value, @execparams);
if ($executable eq 'blastall') {@execparams = @BLASTALL_PARAMS; }
if ($executable eq 'blastpgp') {@execparams = @BLASTPGP_PARAMS; }
if ($executable eq 'bl2seq') {@execparams = @BL2SEQ_PARAMS; }
my $param_string = "";
for $attr ( @execparams ) {
$value = $self->$attr();
next unless (defined $value);
# Need to prepend datadirectory to database name
if ($attr eq 'd' && ($executable ne 'bl2seq')) {
# This is added so that you can specify a DB with a full path
if (! (-e $value.".nin" || -e $value.".pin")){
$value = File::Spec->catdir($DATADIR,$value);
}
}
# put params in format expected by Blast
$attr = '-'. $attr ;
$param_string .= " $attr $value ";
}
# if ($self->quiet()) { $param_string .= ' >/dev/null';}
return $param_string;
}
=head1 Bio::Tools::Run::Wrapper methods
=cut
=head2 no_param_checks
Title : no_param_checks
Usage : $obj->no_param_checks($newval)
Function: Boolean flag as to whether or not we should
trust the sanity checks for parameter values
Returns : value of no_param_checks
Args : newvalue (optional)
=cut
=head2 save_tempfiles
Title : save_tempfiles
Usage : $obj->save_tempfiles($newval)
Function:
Returns : value of save_tempfiles
Args : newvalue (optional)
=cut
=head2 outfile_name
Title : outfile_name
Usage : my $outfile = $tcoffee->outfile_name();
Function: Get/Set the name of the output file for this run
(if you wanted to do something special)
Returns : string
Args : [optional] string to set value to
=cut
=head2 tempdir
Title : tempdir
Usage : my $tmpdir = $self->tempdir();
Function: Retrieve a temporary directory name (which is created)
Returns : string which is the name of the temporary directory
Args : none
=cut
=head2 cleanup
Title : cleanup
Usage : $tcoffee->cleanup();
Function: Will cleanup the tempdir directory after a PAML run
Returns : none
Args : none
=cut
=head2 io
Title : io
Usage : $obj->io($newval)
Function: Gets a L object
Returns : L
Args : none
=cut
sub DESTROY {
my $self= shift;
unless ( $self->save_tempfiles ) {
$self->cleanup();
}
$self->SUPER::DESTROY();
}
1;
__END__