Raw content of XrefParser::CodelinkParser package XrefParser::CodelinkParser; use strict; use File::Basename; use base qw( XrefParser::BaseParser ); # Parser for Codelink probes #>GE469530 #TTGTTTTCAGCTTGCTTCTGTCATTCTTCC #>GE469548 #CACAGTTGGGTGAAGCTGGTGATGAAGGTA sub run { my $self = shift if (defined(caller(1))); my $source_id = shift; my $species_id = shift; my $files = shift; my $release_file = shift; my $verbose = shift; my $file = @{$files}[0]; my @xrefs; local $/ = "\n>"; my $codelink_io = $self->get_filehandle($file); if ( !defined $codelink_io ) { print STDERR "ERROR: Could not open $file\n"; return 1; # 1 = error } while ( $_ = $codelink_io->getline() ) { my $xref; my ($header, $sequence) = $_ =~ /^>?(.+?)\n([^>]*)/s or warn("Can't parse FASTA entry: $_\n"); # deconstruct header - only accession for now my $accession = $header; # make sequence into one long string - probably not necessary for short probes $sequence =~ s/\n//g; # build the xref object and store it $xref->{ACCESSION} = $accession; $xref->{LABEL} = $accession; $xref->{SEQUENCE} = $sequence; $xref->{SOURCE_ID} = $source_id; $xref->{SPECIES_ID} = $species_id; $xref->{SEQUENCE_TYPE} = 'dna'; $xref->{STATUS} = 'experimental'; push @xrefs, $xref; } $codelink_io->close(); XrefParser::BaseParser->upload_xref_object_graphs(\@xrefs); print scalar(@xrefs) . " Codelink xrefs succesfully parsed\n" if($verbose); return 0; #successful } 1;