Raw content of XrefParser::CodelinkParser
package XrefParser::CodelinkParser;
use strict;
use File::Basename;
use base qw( XrefParser::BaseParser );
# Parser for Codelink probes
#>GE469530
#TTGTTTTCAGCTTGCTTCTGTCATTCTTCC
#>GE469548
#CACAGTTGGGTGAAGCTGGTGATGAAGGTA
sub run {
my $self = shift if (defined(caller(1)));
my $source_id = shift;
my $species_id = shift;
my $files = shift;
my $release_file = shift;
my $verbose = shift;
my $file = @{$files}[0];
my @xrefs;
local $/ = "\n>";
my $codelink_io = $self->get_filehandle($file);
if ( !defined $codelink_io ) {
print STDERR "ERROR: Could not open $file\n";
return 1; # 1 = error
}
while ( $_ = $codelink_io->getline() ) {
my $xref;
my ($header, $sequence) = $_ =~ /^>?(.+?)\n([^>]*)/s or warn("Can't parse FASTA entry: $_\n");
# deconstruct header - only accession for now
my $accession = $header;
# make sequence into one long string - probably not necessary for short probes
$sequence =~ s/\n//g;
# build the xref object and store it
$xref->{ACCESSION} = $accession;
$xref->{LABEL} = $accession;
$xref->{SEQUENCE} = $sequence;
$xref->{SOURCE_ID} = $source_id;
$xref->{SPECIES_ID} = $species_id;
$xref->{SEQUENCE_TYPE} = 'dna';
$xref->{STATUS} = 'experimental';
push @xrefs, $xref;
}
$codelink_io->close();
XrefParser::BaseParser->upload_xref_object_graphs(\@xrefs);
print scalar(@xrefs) . " Codelink xrefs succesfully parsed\n" if($verbose);
return 0; #successful
}
1;