Raw content of XrefParser::IlluminaParser
<![CDATA[package XrefParser::IlluminaParser;
use strict;
use base qw( XrefParser::BaseParser );
# Parser for Illumina V2 xrefs - V1 are done by the vanilla FastaParser
# Search_key,Target,ProbeId,Gid,Transcript,Accession,Symbol,Type,Start,Probe_Sequence,Definition,Ontology,Synonym
# ILMN_89282,ILMN_89282,0004760445,23525203,Hs.388528,BU678343,"",S,349,CTCTCTAAAGGGACAACAGAGTGGACAGTCAAGGAACTCCACATATTCAT,"UI-CF-EC0-abi-c-12-0-UI.s1 UI-CF-EC0 Homo sapiens cDNA clone UI-CF-EC0-abi-c-12-0-UI 3, mRNA sequence",,
# ILMN_35826,ILMN_35826,0002760372,89042416,XM_497527.2,XM_497527.2,"LOC441782",S,902,GGGGTCAAGCCCAGGTGAAATGTGGATTGGAAAAGTGCTTCCCTTGCCCC,"PREDICTED: Homo sapiens similar to spectrin domain with coiled-coils 1 (LOC441782), mRNA.",,
# Note that "definition" column often has commas.
sub run {
my $self = shift if (defined(caller(1)));
my $source_id = shift;
my $species_id = shift;
my $files = shift;
my $release_file = shift;
my $verbose = shift;
my $file = @{$files}[0];
my @xrefs;
my $file_io = $self->get_filehandle($file);
if ( !defined $file_io ) {
print STDERR "Could not open $file\n";
return 1;
}
while ( $_ = $file_io->getline() ) {
chomp;
my $xref;
# strip ^M at end of line
$_ =~ s/\015//g;
my @bits = split(/,[^ ]/);
my $illumina_id = $bits[0];
next if ($illumina_id eq "Search_key"); # skip header
next if (!$illumina_id); # skip lines with missing accessions
my $sequence = $bits[9];
my $type = $bits[7];
# XXX what about "type" column?
my ($description) = $bits[10];
$description =~ s/\"//g;
# build the xref object and store it
$xref->{ACCESSION} = $illumina_id;
$xref->{LABEL} = $illumina_id;
$xref->{SEQUENCE} = $sequence;
$xref->{SOURCE_ID} = $source_id;
$xref->{SPECIES_ID} = $species_id;
$xref->{DESCRIPTION} = $description;
$xref->{SEQUENCE_TYPE} = 'dna';
$xref->{STATUS} = 'experimental';
push @xrefs, $xref;
}
$file_io->close();
XrefParser::BaseParser->upload_xref_object_graphs(\@xrefs);
print scalar(@xrefs) . " Illumina V2 xrefs succesfully parsed\n" if($verbose);
return 0;
}
1;
]]>