Raw content of Bio::EnsEMBL::DBSQL::SequenceAdaptor
<![CDATA[=head1 LICENSE
Copyright (c) 1999-2009 The European Bioinformatics Institute and
Genome Research Limited. All rights reserved.
This software is distributed under a modified Apache license.
For license details, please see
/info/about/code_licence.html
=head1 CONTACT
Please email comments or questions to the public Ensembl
developers list at <ensembl-dev@ebi.ac.uk>.
Questions may also be sent to the Ensembl help desk at
<helpdesk@ensembl.org>.
=cut
=head1 NAME
Bio::EnsEMBL::DBSQL::SequenceAdaptor - produce sequence strings from locations
=head1 SYNOPSIS
my $sa = $registry->get_adaptor( 'Human', 'Core', 'Sequence' );
my $dna =
${ $sa->fetch_by_Slice_start_end_strand( $slice, 1, 1000, -1 ) };
=head1 DESCRIPTION
An adaptor for the retrieval of DNA sequence from the EnsEMBL database
=head1 METHODS
=cut
package Bio::EnsEMBL::DBSQL::SequenceAdaptor;
use vars qw(@ISA @EXPORT);
use strict;
use Bio::EnsEMBL::DBSQL::BaseAdaptor;
use Bio::EnsEMBL::Utils::Exception qw(throw deprecate);
use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);
use Bio::EnsEMBL::Utils::Cache;
@ISA = qw(Bio::EnsEMBL::DBSQL::BaseAdaptor);
our $SEQ_CHUNK_PWR = 18; # 2^18 = approx. 250KB
our $SEQ_CACHE_SZ = 5;
our $SEQ_CACHE_MAX = (2 ** $SEQ_CHUNK_PWR) * $SEQ_CACHE_SZ;
@EXPORT = (@{$DBI::EXPORT_TAGS{'sql_types'}});
=head2 new
Arg [1] : none
Example : my $sa = $db_adaptor->get_SequenceAdaptor();
Description: Constructor. Calls superclass constructor and initialises
internal cache structure.
Returntype : Bio::EnsEMBL:DBSQL::SequenceAdaptor
Exceptions : none
Caller : DBAdaptor::get_SequenceAdaptor
Status : Stable
=cut
sub new {
my $caller = shift;
my $class = ref($caller) || $caller;
my $self = $class->SUPER::new(@_);
# use an LRU cache to limit the size
my %seq_cache;
tie(%seq_cache, 'Bio::EnsEMBL::Utils::Cache', $SEQ_CACHE_SZ);
$self->{'seq_cache'} = \%seq_cache;
return $self;
}
=head2 fetch_by_Slice_start_end_strand
Arg [1] : Bio::EnsEMBL::Slice slice
The slice from which you want the sequence
Arg [2] : (optional) int startBasePair
The start base pair relative to the start of the slice. Negative
values or values greater than the length of the slice are fine.
default = 1
Arg [3] : (optional) int endBasePair
The end base pair relative to the start of the slice. Negative
values or values greater than the length of the slice are fine,
but the end must be greater than or equal to the start
count from 1
default = the length of the slice
Arg [4] : (optional) int strand
1, -1
default = 1
Example : $dna = $seq_adptr->fetch_by_Slice_start_end_strand($slice, 1,
1000, -1);
Description: retrieves from db the sequence for this slice
uses AssemblyMapper to find the assembly
Returntype : string
Exceptions : endBasePair should be less or equal to length of slice
Caller : Bio::EnsEMBL::Slice::seq(), Slice::subseq()
Status : Stable
=cut
sub fetch_by_Slice_start_end_strand {
my ( $self, $slice, $start, $end, $strand ) = @_;
if(!ref($slice) || !$slice->isa("Bio::EnsEMBL::Slice")) {
throw("Slice argument is required.");
}
$start = 1 if(!defined($start));
$end = $slice->end() - $slice->start() + 1 if(!defined($end));
throw("Start must be less than or equal to end.") if($start > $end);
$strand ||= 1;
#get a new slice that spans the exact region to retrieve dna from
my $right_expand = $end - $slice->length(); #negative is fine
my $left_expand = 1 - $start; #negative is fine
if($right_expand || $left_expand) {
$slice = $slice->expand($left_expand, $right_expand);
}
#retrieve normalized 'non-symlinked' slices
#this allows us to support haplotypes and PARs
my $slice_adaptor = $slice->adaptor();
my @symproj=@{$slice_adaptor->fetch_normalized_slice_projection($slice)};
if(@symproj == 0) {
throw('Could not retrieve normalized Slices. Database contains ' .
'incorrect assembly_exception information.');
}
#call this method again with any slices that were 'symlinked' to by this
#slice
if(@symproj != 1 || $symproj[0]->[2] != $slice) {
my $seq;
foreach my $segment (@symproj) {
my $symlink_slice = $segment->[2];
#get sequence from each symlinked area
$seq .= ${$self->fetch_by_Slice_start_end_strand($symlink_slice,
1,undef,1)};
}
if($strand == -1) {
reverse_comp(\$seq);
}
return \$seq;
}
# we need to project this slice onto the sequence coordinate system
# even if the slice is in the same coord system, we want to trim out
# flanking gaps (if the slice is past the edges of the seqregion)
my $csa = $self->db->get_CoordSystemAdaptor();
my $seqlevel = $csa->fetch_sequence_level();
my @projection=@{$slice->project($seqlevel->name(), $seqlevel->version())};
my $seq = '';
my $total = 0;
my $tmp_seq;
#fetch sequence from each of the sequence regions projected onto
foreach my $segment (@projection) {
my ($start, $end, $seq_slice) = @$segment;
#check for gaps between segments and pad them with Ns
my $gap = $start - $total - 1;
if($gap) {
$seq .= 'N' x $gap;
}
my $seq_region_id = $slice_adaptor->get_seq_region_id($seq_slice);
$tmp_seq = ${$self->_fetch_seq($seq_region_id,
$seq_slice->start, $seq_slice->length())};
#reverse compliment on negatively oriented slices
if($seq_slice->strand == -1) {
reverse_comp(\$tmp_seq);
}
$seq .= $tmp_seq;
$total = $end;
}
#check for any remaining gaps at the end
my $gap = $slice->length - $total;
if($gap) {
$seq .= 'N' x $gap;
}
#if the sequence is too short it is because we came in with a seqlevel
#slice that was partially off of the seq_region. Pad the end with Ns
#to make long enough
if(length($seq) != $slice->length()) {
$seq .= 'N' x ($slice->length() - length($seq));
}
#if they asked for the negative slice strand revcomp the whole thing
reverse_comp(\$seq) if($strand == -1);
return \$seq;
}
sub _fetch_seq {
my $self = shift;
my $seq_region_id = shift;
my $start = shift;
my $length = shift;
my $cache = $self->{'seq_cache'};
if($length < $SEQ_CACHE_MAX) {
my $chunk_min = ($start-1) >> $SEQ_CHUNK_PWR;
my $chunk_max = ($start + $length - 1) >> $SEQ_CHUNK_PWR;
# piece together sequence from cached component parts
my $entire_seq = undef;
for(my $i = $chunk_min; $i <= $chunk_max; $i++) {
if($cache->{"$seq_region_id:$i"}) {
$entire_seq .= $cache->{"$seq_region_id:$i"};
} else {
# retrieve uncached portions of the sequence
my $sth =
$self->prepare( "SELECT SUBSTRING(d.sequence, ?, ?) "
. "FROM dna d "
. "WHERE d.seq_region_id = ?" );
my $tmp_seq;
my $min = ($i << $SEQ_CHUNK_PWR) + 1;
$sth->bind_param( 1, $min, SQL_INTEGER );
$sth->bind_param( 2, 1 << $SEQ_CHUNK_PWR, SQL_INTEGER );
$sth->bind_param( 3, $seq_region_id, SQL_INTEGER );
$sth->execute();
$sth->bind_columns(\$tmp_seq);
$sth->fetch();
$sth->finish();
# always give back uppercased sequence so it can be properly softmasked
$entire_seq .= uc($tmp_seq);
$cache->{"$seq_region_id:$i"} = $tmp_seq;
}
}
# return only the requested portion of the entire sequence
my $min = ( $chunk_min << $SEQ_CHUNK_PWR ) + 1;
my $max = ( $chunk_max + 1 ) << $SEQ_CHUNK_PWR;
my $seq = substr( $entire_seq, $start - $min, $length );
return \$seq;
} else {
# do not do any caching for requests of very large sequences
my $sth =
$self->prepare( "SELECT SUBSTRING(d.sequence, ?, ?) "
. "FROM dna d "
. "WHERE d.seq_region_id = ?" );
my $tmp_seq;
$sth->bind_param( 1, $start, SQL_INTEGER );
$sth->bind_param( 2, $length, SQL_INTEGER );
$sth->bind_param( 3, $seq_region_id, SQL_INTEGER );
$sth->execute();
$sth->bind_columns(\$tmp_seq);
$sth->fetch();
$sth->finish();
# always give back uppercased sequence so it can be properly softmasked
$tmp_seq = uc($tmp_seq);
return \$tmp_seq;
}
}
=head2 store
Arg [1] : int $seq_region_id the id of the sequence region this dna
will be associated with.
Arg [2] : string $sequence the dna sequence to be stored
in the database. Note that the sequence passed in will be
converted to uppercase.
Example : $seq_adaptor->store(11, 'ACTGGGTACCAAACAAACACAACA');
Description: stores a dna sequence in the databases dna table and returns the
database identifier for the new record.
Returntype : none
Exceptions : throw if the database insert fails
Caller : sequence loading scripts
Status : Stable
=cut
sub store {
my ($self, $seq_region_id, $sequence) = @_;
if(!$seq_region_id) {
throw('seq_region_id is required');
}
$sequence = uc($sequence);
my $statement =
$self->prepare("INSERT INTO dna(seq_region_id, sequence) VALUES(?,?)");
$statement->bind_param(1,$seq_region_id,SQL_INTEGER);
$statement->bind_param(2,$sequence,SQL_LONGVARCHAR);
$statement->execute();
$statement->finish();
return;
}
=head2 fetch_by_assembly_location
Description: DEPRECATED use fetch_by_Slice_start_end_strand() instead.
=cut
sub fetch_by_assembly_location {
my ( $self, $chrStart, $chrEnd,
$strand, $chrName, $assemblyType ) = @_;
deprecate('Use fetch_by_Slice_start_end_strand() instead');
my $csa = $self->db->get_CoordSystem();
my $top_cs = @{$csa->fetch_all};
my $slice_adaptor = $self->db->get_SliceAdaptor();
my $slice = $slice_adaptor->fetch_by_region($top_cs->name(), $chrName,
$chrStart, $chrEnd,
$strand, $top_cs->version);
return $self->fetch_by_Slice_start_end_strand($slice,1, $slice->length,1);
}
=head2 fetch_by_RawContig_start_end_strand
Description: DEPRECATED use fetch_by_Slice_start_end_strand instead
=cut
sub fetch_by_RawContig_start_end_strand {
deprecate('Use fetch_by_Slice_start_end_strand instead.');
fetch_by_Slice_start_end_strand(@_);
}
1;
]]>