Raw content of Bio::EnsEMBL::Utils::Sequence
<![CDATA[=head1 LICENSE
Copyright (c) 1999-2009 The European Bioinformatics Institute and
Genome Research Limited. All rights reserved.
This software is distributed under a modified Apache license.
For license details, please see
/info/about/code_licence.html
=head1 CONTACT
Please email comments or questions to the public Ensembl
developers list at <ensembl-dev@ebi.ac.uk>.
Questions may also be sent to the Ensembl help desk at
<helpdesk@ensembl.org>.
=cut
=head1 NAME
Bio::EnsEMBL::Utils::Sequence - Utility functions for sequences
=head1 SYNOPSIS
use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp expand);
my $seq = 'ACTTTAAAGGCTATCCCAATATG';
print "my sequence = $seq\n";
reverse_comp( \$seq );
print "my reverse comp = $seq\n";
my $compressed_seq = '(AC)3';
print "my expanded seq is = expand($compressed_seq)";
=head1 METHODS
=cut
package Bio::EnsEMBL::Utils::Sequence;
use strict;
use warnings;
use Exporter;
use vars qw(@ISA @EXPORT_OK);
@ISA = qw(Exporter);
@EXPORT_OK = qw(&reverse_comp &expand);
=head2 reverse_comp
Arg [1] : reference to a string $seqref
Example : use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);
$seq = 'ACCTGAA';
reverse_comp(\$seq);
print $seq;
Description: Does an in place reverse compliment of a passed in string
reference. The string is passed by reference
rather than by value for memory efficiency.
Returntype : none
Exceptions : none
Caller : SequenceAdaptor, SliceAdaptor
=cut
sub reverse_comp {
my $seqref = shift;
$$seqref = reverse( $$seqref );
$$seqref =~
tr/acgtrymkswhbvdnxACGTRYMKSWHBVDNX/tgcayrkmswdvbhnxTGCAYRKMSWDVBHNX/;
return;
}
=head2 expand
Arg [1] : reference to a string $seqref
Example : use Bio::EnsEMBL::Utils::Sequence qw(expand);
$seq = '(AC)3';
expand(\$seq);
print $seq;
Description: Expands a genomic sequence. The string is passed by reference
rather than by value for memory efficiency.
Returntype : none
Exceptions : none
Caller : SequenceAdaptor, SliceAdaptor
=cut
sub expand {
my $seq_ref = shift;
$$seq_ref =~ s/(\w*)\((\w+)\)(\d+)/$1.$2 x $3/eg if ($$seq_ref =~ /\(/);#expressions with parenthesis, expand the alleles
return;
}
1;
]]>