Bio::Map
Microsatellite
Toolbar
Summary
Bio::Map::Microsatellite - An object representing a Microsatellite marker.
Package variables
No package variables defined.
Included modules
Inherit
Synopsis
$o_usat = new Bio::Map::Microsatellite
(-name=>'Chad Super Marker 2',
-sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
-motif => 'at',
-repeats => 15,
-repeat_start_position => 11
);
$sequence_before_usat = $o_usat->get_leading_flank();
$sequence_after_usat = $o_usat->get_trailing_flank();
Description
This object handles the notion of an Microsatellite. This microsatellite can
be placed on a (linear) Map or used on its own. If this Microsatellites
will be used in a mapping context (it doesn't have to, you know) it can have
multiple positions in a map. For information about a Microsatellite's position
in a map one must query the associate PositionI object which is accessible
through the position() method.
Methods
Methods description
Title : equals
Usage : if( $mappable->equals($mapable2)) ...
Function: Test if a position is equal to another position
Returns : boolean
Args : Bio::Map::MappableI |
Title : get_leading_flank()
Usage : $leading_sequence = $o_usat->get_leading_flank();
Returns : A scalar representing the sequence before the repeats in this
Microsatellite.
Args : None. |
Title : get_trailing_flank()
Usage : $trailing_flank = $o_usat->get_trailing_flank();
Returns : A scalar representing the sequence after the repeats in this
Microsatellite.
Args : None. |
Title : greater_than
Usage : if( $mappable->greater_than($m2) ) ...
Function: Tests if position is greater than another position
Returns : boolean
Args : Bio::Map::MappableI |
Title : less_than
Usage : if( $mappable->less_than($m2) ) ...
Function: Tests if a position is less than another position
Returns : boolean
Args : Bio::Map::MappableI |
Title : motif($new_motif)
Usage : my $motif = $o_usat->motif($new_motif) _or_
my $motif = $o_usat->motif()
Function: Get/Set the repeat motif for this Microsatellite
Returns : A scalar representing the current repeat motif of this
Microsatellite.
Args : If provided, the current repeat motif of this Microsatellite
will be set to $new_motif. |
Title : new
Usage : $o_usat =
Function: Builds a new Bio::Map::Microsatellite object
Returns : Bio::Map::Microsatellite
Args :
-name => name of this microsatellite (optional, string,
default 'Unknown microsatellite')
-positions => position(s) for this marker in maps[optional],
An array reference of tuples (array refs themselves)
Each tuple conatins a Bio::Map::MapI-inherited object and a
Bio::Map::PositionI-inherited obj, no default)
-sequence => the sequence of this microsatellite (optional,
scalar, no default)
-motif => the repeat motif of this microsatellite (optional,
scalar, no default)
-repeats => the number of motif repeats for this microsatellite
(optional, scalar, no default)
-repeat_start_position => the starting position of the
microsatellite in this sequence. The first base of the
sequence is position "1". (optional, scalar, no default)
Note : Creating a Bio::Map::Microsatellite object with no position
might be useful for microsatellite people wanting to embrace
and extend this module. Me! Me! Me!
- using repeat_start_position will trigger a mechinism to
calculate a value for repeat_end_position. |
Title : repeat_end_position($set)
Usage : $new_repeat_end_position =
$o_usat->repeat_end_position("set"); _or_
$new_repeat_end_position =
$o_usat->repeat_end_position($value); _or_
$current_repeat_end_position = $o_usat->repeat_end_position();
Function: get/set the end position of the repeat in this sequence
Returns : A scalar representing the base index of the end of the
repeat in this Microsatellite. The first base in the sequence
is base 1.
Args : A scalar representing a value, the string "set", or no
argument (see Notes).
Notes : If you do not provide an argument to this method, the current
end position of the repeat in this Microsatellite will be
returned (a scalar).
If you provide the string "set" to this method it will set the
end position based on the start position, the length of the
motif, and the nuimber of repeats.
If you specify a value the current end position of the repeat
will be set to that value. This is a really bad idea. Don't do
it. |
Title : repeat_start_position($new_repeat_start_position)
Usage : my $repeat_start_position =
$o_usat->repeat_start_position($new_repeat_start_position) _or_
my $repeat_start_position = $o_usat->repeat_start_position()
Function: Get/Set the repeat repeat_start_position for this
Microsatellite
Returns : A scalar representing the repeat start position for this
Microsatellite.
Args : If provided, the current repeat start position of this
Microsatellite will be set to $new_repeat_start_position.
This method will also try to set the repeat end position. This
depends on having information for the motif and the number of
repeats. If you want to use methods like get_trailing_flank or
get_leading flank, be careful to include the right information. |
Title : repeats($new_repeats)
Usage : my $repeats = $o_usat->repeats($new_repeats) _or_
my $repeats = $o_usat->repeats()
Function: Get/Set the repeat repeats for this Microsatellite
Returns : A scalar representing the current number of repeats of this
Microsatellite.
Args : If provided, the current number of repeats of this
Microsatellite will be set to $new_repeats. |
Title : sequence($new_sequence)
Usage : my $sequence = $o_usat->sequence($new_sequence) _or_
my $sequence = $o_usat->sequence()
Function: Get/Set the sequence for this Microsatellite
Returns : A scalar representing the current sequence of this
Microsatellite.
Args : If provided, the current sequence of this Microsatellite
will be set to $new_sequence. |
Methods code
sub equals
{ my ($self,@args) = @_;
$self->warn("equals is not yet implemented in ".
ref($self)." yet. Check back real soon!");} | sub get_leading_flank
{ my $self = shift;
return substr $self->sequence(),0,$self->repeat_start_position-1; } | sub get_trailing_flank
{ my $self = shift;
return substr $self->sequence(),$self->repeat_end_position()-1;
}
1; } | sub greater_than
{ my ($self,@args) = @_;
$self->warn("greater_then is not yet implemented in ".
ref($self)." yet. Check back real soon!");} | sub less_than
{ my ($self,@args) = @_;
$self->warn("less_then is not yet implemented in ".
ref($self)." yet. Check back real soon!");} | sub motif
{ my ($self,$motif) = @_;
if ($motif) {
$self->{'_motif'} = $motif;
}
return $self->{'_motif'};} | sub new
{ my ($class,@args) = @_;
my $self = $class->SUPER::new(@args);
my ($map, $position, $sequence, $motif, $repeats, $start) =
$self->_rearrange([qw(MAP
POSITION
SEQUENCE
MOTIF
REPEATS
REPEAT_START_POSITION
)], @args);
if( ! $self->name ) {
$self->name('Unnamed microsatellite');
}
$map && $self->map($map);
$position && $self->position($position);
$sequence && $self->sequence($sequence);
$self->motif(defined $motif ? $motif : 'Unknown motif');
$repeats && $self->repeats($repeats);
$start && $self->repeat_start_position($start);
return $self;} | sub repeat_end_position
{ my ($self,$caller) = @_;
if( defined $caller ) {
if ($caller eq "set") {
$self->{'_repeat_end_position'} =
$self->{'_repeat_start_position'} +
(length($self->motif()) * $self->repeats());
}
elsif ($caller) {
$self->{'_repeat_end_position'} = $caller;
}
}
return $self->{'_repeat_end_position'};} | sub repeat_start_position
{ my ($self,$repeat_start_position) = @_;
if ($repeat_start_position) {
$self->{'_repeat_start_position'} = $repeat_start_position;
$self->repeat_end_position("set");
}
return $self->{'_repeat_start_position'};} | sub repeats
{ my ($self,$repeats) = @_;
if ($repeats) {
$self->{'_repeats'} = $repeats;
}
return $self->{'_repeats'};} | sub sequence
{ my ($self,$sequence) = @_;
if ($sequence) {
$self->{'_sequence'} = $sequence;
}
return $self->{'_sequence'};} | General documentation
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/MailList.shtml - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
email or the web:
bioperl-bugs@bioperl.org
http://bugzilla.bioperl.org/
| AUTHOR - Chad Matsalla | Top |
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
| Bio::Map::Marker methods | Top |
Title : position
Usage : my $position = $mappable->position($map); OR
$mappable->position($map,$position); OR
Function: Get/Set the Bio::Map::PositionI for a mappable element
in a specific Map
Returns : Bio::Map::PositionI
Args : $map =Bio::Map::MapI # Map we are talking about
$position = Bio::Map::PositionI # Position we want to set
Title : name($new_name)
Usage : $o_usat->name($new_name) _or_
my $name = $o_usat->name()
Function: Get/Set the name for this Microsatellite
Returns : A scalar representing the current name of this Microsatellite
Args : If provided, the current name of this Microsatellite
will be set to $new_name.