Bio::Seq
PrimedSeq
Toolbar
Package variables
Privates (from "my" definitions)
$static_gff_formatter = undef
Included modules
Inherit
Synopsis
# create a sequence
my $sequence = "ctagctagctagctagctagctagctagctgatcgtagctagctagct";
# create left and right primer seqfeatures
# unfortunately, I haven't created constructors for these yet.
my $left = Bio::SeqFeature::Primer();
my $right = Bio::SeqFeature::Primer();
# now create the PrimedSeq
$primedseq = new Bio::Seq::PrimedSeq(
-seq => $sequence,
-display_id => "chads_fantastic_sequence",
-LEFT_PRIMER => $left,
-RIGHT_PRIMER => $right,
-TARGET => '513,26'
-PRIMER_PRODUCT_SIZE_RANGE => '100-500'
-PRIMER_FILE_FLAG => '0'
-PRIMER_LIBERAL_BASE => '1'
-PRIMER_NUM_RETURN => '1'
-PRIMER_FIRST_BASE_INDEX => '1'
-PRIMER_EXPLAIN_FLAG => '1'
-PRIMER_PRODUCT_SIZE => '185'
);
# get the amplified region
my $amplified_sequence = $primed_seq->get_amplified_sequence();
Description
This module is a slightly glorified capsule containg a primed seqBuence. It was
created to address the fact that a primer is more the a seqfeature and there
need to be ways to represent the primer-sequence complex and the behaviors and
attributes that are associated with the complex.
Methods
Methods description
Title : _static_gff_formatter Usage : Function: Example : Returns : Args : |
Title : all_tags Usage : @tags = $feat->all_tags() Function: gives all tags for this feature Returns : an array of strings Args : none |
Title : display_id Usage : $name = $feat->display_id() Function: Returns the human-readable ID of the feature for displays. Returns : a string Args : none |
Title : each_tag_value Usage : @values = $self->each_tag_value('some_tag') Function: Returns : An array comprising the values of the specified tag. Args : |
Title : gff_string Usage : $str = $feat->gff_string; $str = $feat->gff_string($gff_formatter); Function: Provides the feature information in GFF format.
The implementation provided here returns GFF2 by default. If you
want a different version, supply an object implementing a method
gff_string() accepting a SeqFeatureI object as argument. E.g., to
obtain GFF1 format, do the following:
my $gffio = Bio::Tools::GFF->new(-gff_version => 1);
$gff1str = $feat->gff_string($gff1io);
Returns : A string
Args : Optionally, an object implementing gff_string(). |
Title : has_tag Usage : $tag_exists = $self->has_tag('some_tag') Function: Returns : TRUE if the specified tag exists, and FALSE otherwise Args : |
Title : location Usage : my $location = $seqfeature->location() Function: returns a location object suitable for identifying location of feature on sequence or parent feature Returns : Bio::LocationI object Args : none |
Title : new() Usage : $primed_sequence = new Bio::SeqFeature::Primer( -seq => $sequence, -left_primer => $left_primer, -right_primer => $right_primer); Function: A constructor for an object representing a primed sequence Returns : A Bio::Seq::PrimedSeq object Args : -seq => a Bio::Seq object -left_primer => a Bio::SeqFeature::Primer object -right_primer => a Bio::SeqFeature::Primer object Many other parameters can be included including all of the output parameters from the primer3 program. Developer Notes: This is incomplete and doesn't work. As of ISMB2002 I am working on it. |
Title : primary_tag Usage : $tag = $feat->primary_tag() Function: Returns the primary tag for a feature, eg 'exon' Returns : a string Args : none |
Title : source_tag Usage : $tag = $feat->source_tag() Function: Returns the source tag for a feature, eg, 'genscan' Returns : a string Args : none |
Title : sub_SeqFeature Usage : @feats = $feat->sub_SeqFeature(); Function: Returns an array of sub Sequence Features Returns : An array Args : none |
Methods code
sub _static_gff_formatter
{ my ($self,@args) = @_;
if( !defined $static_gff_formatter ) {
$static_gff_formatter = Bio::Tools::GFF->new('-gff_version' => 2);
}
return $static_gff_formatter; } |
sub all_tags
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub display_id
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub each_tag_value
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub end()
{ my $self = shift; } |
sub get_left_primer()
{ my $self = shift; } |
sub gff_string
{ my ($self,$formatter) = @_;
$formatter = $self->_static_gff_formatter unless $formatter;
return $formatter->gff_string($self);
}
my $static_gff_formatter = undef; } |
sub has_tag
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub location
{ my ($self) = @_;
$self->throw_not_implemented();
}
1; } |
sub new
{ my($class,@args) = @_;
my %arguments = @args;
my $self = $class->SUPER::new(@args);
my $newkey;
foreach my $key (sort keys %arguments) {
($newkey = $key) =~ s/-//;
$self->{$newkey} = $arguments{$key};
push @{$self->{arguments}},$newkey;
}
if (!$self->{target_sequence} || !$self->{left_primer} || !$self->{right_primer} ) {
$self->throw("You must provide a target_sequence, left_primer, and right_primer to create this object.");
}
if (ref($self->{target_sequence}) ne "Bio::Seq") {
$self->throw("The target_sequence must be a Bio::Seq to create this object.");
}
if (ref($self->{left_primer}) ne "Bio::SeqFeature::Primer" || ref($self->{right_primer}) ne "Bio::SeqFeature::Primer") {
$self->throw("You must provide a left_primer and right_primer, both as Bio::SeqFeature::Primer to create this object.");
}
return $self; } |
sub primary_tag
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub source_tag
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub start()
{ my $self = shift; } |
sub strand()
{ my $self = shift; } |
sub sub_SeqFeature
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
General documentation
Bio::Seq::PrimedSeq - A representation of a sequence and two primers flanking a
target region for amplification
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bio.perl.org/MailList.html - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
bioperl-bugs@bio.perl.org
http://bugzilla.bioperl.org/
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
Title : get_left_primer();
Usage : $left_primer = $primedseq->get_left_primer();
Function: A getter for the left primer in thie PrimedSeq object.
Returns : A Bio::SeqFeature::Primer object
Args : None.
List of interfaces inherited from Bio::RangeI (see
Bio::RangeIfor details).
Title : start
Usage : $start = $feat->start
Function: Returns the start coordinate of the feature
Returns : integer
Args : none
Developer Notes:
This is entirely dependent on the sequence to which this primer is attached!
I think that there could be trouble if one takes this primer from sequence 1
and naively place it on sequence 2 without updating this
** This is incomplete at this time.
Title : end
Usage : $end = $feat->end
Function: Returns the end coordinate of the feature
Returns : integer
Args : none
Developer Notes:
** This is incomplete at this time.
Title : strand
Usage : $strand = $feat->strand()
Function: Returns strand information, being 1,-1 or 0
Returns : -1,1 or 0
Args : none
Developer Notes:
** This is incomplete at this time.
SeqFeatureI specific methods | Top |
New method interfaces.
These methods are inherited from RangeI and can be used
directly from a SeqFeatureI interface. Remember that a
SeqFeature is-a RangeI, and so wherever you see RangeI you
can use a feature ($r in the below documentation).
Title : overlaps
Usage : if($feat->overlaps($r)) { do stuff }
if($feat->overlaps(200)) { do stuff }
Function: tests if $feat overlaps $r
Args : a RangeI to test for overlap with, or a point
Returns : true if the Range overlaps with the feature, false otherwise
Title : contains
Usage : if($feat->contains($r) { do stuff }
Function: tests whether $feat totally contains $r
Args : a RangeI to test for being contained
Returns : true if the argument is totaly contained within this range
Title : equals
Usage : if($feat->equals($r))
Function: test whether $feat has the same start, end, strand as $r
Args : a RangeI to test for equality
Returns : true if they are describing the same range
These methods do things to the geometry of ranges, and return
triplets (start, stop, strand) from which new ranges could be built.
Title : intersection
Usage : ($start, $stop, $strand) = $feat->intersection($r)
Function: gives the range that is contained by both ranges
Args : a RangeI to compare this one to
Returns : nothing if they do not overlap, or the range that they do overlap
Title : union
Usage : ($start, $stop, $strand) = $feat->union($r);
: ($start, $stop, $strand) = Bio::RangeI->union(@ranges);
Function: finds the minimal range that contains all of the ranges
Args : a range or list of ranges to find the union of
Returns : the range containing all of the ranges