Bio
PrimarySeq
Toolbar
Summary
Bio::PrimarySeq - Bioperl lightweight Sequence Object
Package variables
Privates (from "my" definitions)
%valid_type = map {$_, 1} qw( dna rna protein )
Included modules
Inherit
Synopsis
# The Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;
#make from memory
$seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'X78121',
-alphabet => 'dna',
-is_circular => 1
);
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, "\n";
# read from file
$inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta');
$seqobj = $inputstream->next_seq();
print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
# to get out parts of the sequence.
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
$string = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);
Description
PrimarySeq is a lightweight Sequence object, storing little more than
the sequence, its name, a computer useful unique name. It does not
contain sequence features or other information. To have a sequence
with sequence features you should use the Seq object which uses this
object - go perldoc Bio::Seq
Although newusers will use Bio::PrimarySeq alot, in general you will
be using it from the Bio::Seq object. For more information on Bio::Seq
go perldoc Bio::Seq. For interest you might like to known that
Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls
to do with sequence to it (the has-a relationship lets us get out of a
otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this
object is a pure Perl implementation of the interface (if that's
gibberish to you, don't worry. The take home message is that this
object is the bioperl default sequence object, but other people can
use their own objects as sequences if they so wish). If you are
interested in wrapping your own objects as compliant Bioperl sequence
objects, then you should read the Bio::PrimarySeqI documentation
The documenation of this object is a merge of the Bio::PrimarySeq and
Bio::PrimarySeqI documentation. This allows all the methods which you can
call on sequence objects here.
Methods
Methods description
Title : _guess_alphabet Usage : Function: Example : Returns : Args : |
Title : accession_number or object_id Usage : $unique_key = $obj->accession_number; Function: Returns the unique biological id for a sequence, commonly called the accession_number. For sequences from established databases, the implementors should try to use the correct accession number. Notice that primary_id() provides the unique id for the implemetation, allowing multiple objects to have the same accession number in a particular implementation.
For sequences with no accession number, this method should
return "unknown".
[Note this method name is likely to change in 1.3]
With the new Bio::IdentifiableI interface, this is aliased
to object_id
Returns : A string
Args : A string (optional) for setting |
Title : alphabet Usage : if( $obj->alphabet eq 'dna' ) { /Do Something/ } Function: Returns the type of sequence being one of 'dna', 'rna' or 'protein'. This is case sensitive.
This is not called because this would cause
upgrade problems from the 0.5 and earlier Seq objects.
Returns : a string either 'dna','rna','protein'. NB - the object must
make a call of the type - if there is no type specified it
has to guess.
Args : none |
Title : authority Usage : $authority = $obj->authority() Function: a string which represents the organisation which granted the namespace, written as the DNS name for organisation (eg, wormbase.org)
Returns : A scalar |
Title : can_call_new Usage : Function: Example : Returns : true Args : |
Title : desc or description Usage : $obj->desc($newval) Function: Get/set description of the sequence.
description is an alias for this for compliance with the
Bio::DescribeableI interface.
Example :
Returns : value of desc (a string)
Args : newvalue (a string or undef, optional) |
Title : description Usage : $string = $obj->description() Function: A text string suitable for displaying to the user a description. This string is likely to have spaces, but should not have any newlines or formatting - just plain text. The string should not be greater than 255 characters and clients can feel justified at truncating strings at 255 characters for the purposes of display
This is aliased to desc().
Returns : A scalar |
Title : display_id or display_name Usage : $id_string = $obj->display_id(); Function: returns the display id, aka the common name of the Sequence object.
The semantics of this is that it is the most likely string to
be used as an identifier of the sequence, and likely to have
"human" readability. The id is equivalent to the ID field of
the GenBank/EMBL databanks and the id field of the
Swissprot/sptrembl database. In fasta format, the >(\S+) is
presumed to be the id, though some people overload the id to
embed other information. Bioperl does not use any embedded
information in the ID field, and people are encouraged to use
other mechanisms (accession field for example, or extending
the sequence object) to solve this.
With the new Bio::DescribeableI interface, display_name aliases
to this method.
Returns : A string
Args : None |
Title : display_name Usage : $string = $obj->display_name() Function: A string which is what should be displayed to the user the string should have no spaces (ideally, though a cautious user of this interface would not assumme this) and should be less than thirty characters (though again, double checking this is a good idea)
This is aliased to display_id().
Returns : A scalar |
Title : id Usage : $id = $seq->id() Function: This is mapped on display_id Example : Returns : Args : |
Title : is_circular Usage : if( $obj->is_circular) { /Do Something/ } Function: Returns true if the molecule is circular Returns : Boolean value Args : none |
Title : length Usage : $len = $seq->length(); Function: Get the length of the sequence in number of symbols (bases or amino acids).
You can also set this attribute, even to a number that does
not match the length of the sequence string. This is useful
if you don''t want to set the sequence too, or if you want
to free up memory by unsetting the sequence. In the latter
case you could do e.g.
$seq->length($seq->length);
$seq->seq(undef);
Note that if you set the sequence to a value other than
undef at any time, the length attribute will be
invalidated, and the length of the sequence string will be
reported again. Also, we won''t let you lie about the length.
Example :
Returns : integer representing the length of the sequence.
Args : Optionally, the value on set |
Title : namespace Usage : $string = $obj->namespace() Function: A string representing the name space this identifier is valid in, often the database name or the name describing the collection
Returns : A scalar |
Title : new Usage : $seq = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT', -id => 'human_id', -accession_number => 'AL000012', );
Function: Returns a new primary seq object from
basic constructors, being a string for the sequence
and strings for id and accession_number.
Note that you can provide an empty sequence string. However, in
this case you MUST specify the type of sequence you wish to
initialize by the parameter -alphabet. See alphabet() for possible
values.
Returns : a new Bio::PrimarySeq object
Args : -seq => sequence string
-display_id => display id of the sequence (locus name)
-accession_number => accession number
-primary_id => primary id (Genbank id)
-namespace => the namespace for the accession
-authority => the authority for the namespace
-desc => description text
-alphabet => sequence type (alphabet) (dna|rna|protein)
-id => alias for display id
-is_circular => boolean field for whether or not sequence is circular |
Title : object_id Usage : $string = $obj->object_id() Function: a string which represents the stable primary identifier in this namespace of this object. For DNA sequences this is its accession_number, similarly for protein sequences
This is aliased to accession_number().
Returns : A scalar |
Title : primary_id Usage : $unique_key = $obj->primary_id; Function: Returns the unique id for this object in this implementation. This allows implementations to manage their own object ids in a way the implementaiton can control clients can expect one id to map to one object.
For sequences with no natural primary id, this method
should return a stringified memory location.
Returns : A string
Args : A string (optional, for setting) |
Title : seq Usage : $string = $obj->seq() Function: Returns the sequence as a string of letters. The case of the letters is left up to the implementer. Suggested cases are upper case for proteins and lower case for DNA sequence (IUPAC standard), but you should not rely on this Returns : A scalar Args : Optionally on set the new value (a string). An optional second argument presets the alphabet (otherwise it will be guessed). Both parameters may also be given in named paramater style with -seq and -alphabet being the names. |
Title : subseq Usage : $substring = $obj->subseq(10,40); Function: returns the subseq from start to end, where the first base is 1 and the number is inclusive, ie 1-2 are the first two bases of the sequence Returns : a string Args : integer for start position integer for end position OR Bio::LocationI location for subseq (strand honored) |
Title : validate_seq Usage : if(! $seq->validate_seq($seq_str) ) { print "sequence $seq_str is not valid for an object of type ", ref($seq), "\n"; } Function: Validates a given sequence string. A validating sequence string must be accepted by seq(). A string that does not validate will lead to an exception if passed to seq().
The implementation provided here does not take alphabet() into
account. Allowed are all letters (A-Z) and '-','.', '*' and '?'.
Example :
Returns : 1 if the supplied sequence string is valid for the object, and
0 otherwise.
Args : The sequence string to be validated. |
Title : version Usage : $version = $obj->version() Function: a number which differentiates between versions of the same object. Higher numbers are considered to be later and more relevant, but a single object described the same identifier should represent the same concept
Returns : A number |
Methods code
sub _guess_alphabet
{ my ($self) = @_;
my ($str,$str2,$total,$atgc,$u,$type);
$str = $self->seq();
$str =~ s/\-\.\?//g;
$total = CORE::length($str);
if( $total == 0 ) {
$self->throw("Got a sequence with no letters in - ".
"cannot guess alphabet [$str]");
}
$u = ($str =~ tr/Uu//);
$atgc = ($str =~ tr/ATGCNatgcn//);
if( ($atgc / $total) > 0.85 ) { $type = 'dna'; } elsif( (($atgc + $u) / $total) > 0.85 ) { $type = 'rna'; } else {
$type = 'protein';
}
$self->alphabet($type);
return $type;
}
} |
sub accession
{ my $self = shift;
$self->warn(ref($self)."::accession is deprecated, ".
"use accession_number() instead");
return $self->accession_number(@_);
}
1;} |
sub accession_number
{ my( $obj, $acc ) = @_;
if (defined $acc) {
$obj->{'accession_number'} = $acc;
} else {
$acc = $obj->{'accession_number'};
$acc = 'unknown' unless defined $acc;
}
return $acc;} |
sub alphabet
{ my ($obj,$value) = @_;
if (defined $value) {
$value = lc $value;
unless ( $valid_type{$value} ) {
$obj->throw("Molecular type '$value' is not a valid type (".
join(',', map "'$_'", sort keys %valid_type) .
") lowercase");
}
$obj->{'alphabet'} = $value;
}
return $obj->{'alphabet'};} |
sub authority
{ my ($obj,$value) = @_;
if( defined $value) {
$obj->{'authority'} = $value;
}
return $obj->{'authority'};} |
sub can_call_new
{ my ($self) = @_;
return 1; } |
sub desc
{ my $self = shift;
return $self->{'desc'} = shift if @_;
return $self->{'desc'};} |
sub description
{ return shift->desc(@_); } |
sub direct_seq_set
{ my $obj = shift;
return $obj->{'seq'} = shift if @_;
return undef;} |
sub display_id
{ my ($obj,$value) = @_;
if( defined $value) {
$obj->{'display_id'} = $value;
}
return $obj->{'display_id'};} |
sub display_name
{ return shift->display_id(@_); } |
sub id
{ return shift->display_id(@_); } |
sub is_circular
{ my $self = shift;
return $self->{'is_circular'} = shift if @_;
return $self->{'is_circular'};} |
sub length
{ my $self = shift;
my $len = CORE::length($self->seq() || '');
if(@_) {
my $val = shift;
if(defined($val) && $len && ($len != $val)) {
$self->throw("You're trying to lie about the length: ".
"is $len but you say ".$val);
}
$self->{'_seq_length'} = $val;
} elsif(defined($self->{'_seq_length'})) {
return $self->{'_seq_length'};
}
return $len;} |
sub namespace
{ my ($self,$value) = @_;
if( defined $value) {
$self->{'namespace'} = $value;
}
return $self->{'namespace'} || "";} |
sub new
{ my ($class, @args) = @_;
my $self = $class->SUPER::new(@args);
my($seq,$id,$acc,$pid,$ns,$auth,$v,$oid,
$desc,$alphabet,$given_id,$is_circular,$direct,$ref_to_seq,$len) =
$self->_rearrange([qw(SEQ
DISPLAY_ID
ACCESSION_NUMBER
PRIMARY_ID
NAMESPACE
AUTHORITY
VERSION
OBJECT_ID
DESC
ALPHABET
ID
IS_CIRCULAR
DIRECT
REF_TO_SEQ
LENGTH
)],
@args);
if( defined $id && defined $given_id ) {
if( $id ne $given_id ) {
$self->throw("Provided both id and display_id constructor ".
"functions. [$id] [$given_id]");
}
}
if( defined $given_id ) { $id = $given_id; }
defined $len && $self->length($len);
$alphabet && $self->alphabet($alphabet);
if( $direct && $ref_to_seq) {
$self->{'seq'} = $$ref_to_seq;
if( ! $alphabet ) {
$self->_guess_alphabet();
} } else {
$self->seq($seq) if defined($seq);
}
$id && $self->display_id($id);
$acc && $self->accession_number($acc);
defined $pid && $self->primary_id($pid);
$desc && $self->desc($desc);
$is_circular && $self->is_circular($is_circular);
$ns && $self->namespace($ns);
$auth && $self->authority($auth);
defined($v) && $self->version($v);
defined($oid) && $self->object_id($oid);
return $self;} |
sub object_id
{ return shift->accession_number(@_); } |
sub primary_id
{ my ($obj,$value) = @_;
if( defined $value) {
$obj->{'primary_id'} = $value;
}
if( ! exists $obj->{'primary_id'} ) {
return "$obj";
}
return $obj->{'primary_id'};} |
sub seq
{ my ($obj,@args) = @_;
if( scalar(@args) == 0 ) {
return $obj->{'seq'};
}
my ($value,$alphabet) = @args;
if(@args) {
if(defined($value) && (! $obj->validate_seq($value))) {
$obj->throw("Attempting to set the sequence to [$value] ".
"which does not look healthy");
}
my $is_changed_seq =
exists($obj->{'seq'}) && (CORE::length($value || '') > 0);
$obj->{'seq'} = $value;
if($alphabet) {
$obj->alphabet($alphabet);
} elsif( $is_changed_seq ||
(! defined($obj->alphabet()))) {
$obj->_guess_alphabet();
} $obj->length(undef) if $is_changed_seq;
}
return $obj->{'seq'};} |
sub subseq
{ my ($self,$start,$end,$replace) = @_;
if( ref($start) && $start->isa('Bio::LocationI') ) {
my $loc = $start;
$replace = $end; my $seq = "";
foreach my $subloc ($loc->each_Location()) {
my $piece = $self->subseq($subloc->start(),
$subloc->end(), $replace);
if($subloc->strand() < 0) {
$piece = Bio::PrimarySeq->new('-seq' => $piece)->revcom()->seq();
}
$seq .= $piece;
}
return $seq;
} elsif( defined $start && defined $end ) {
if( $start > $end ){
$self->throw("in subseq, start [$start] has to be ".
"greater than end [$end]");
}
if( $start <= 0 || $end > $self->length ) {
$self->throw("You have to have start positive\n\tand length less ".
"than the total length of sequence [$start:$end] ".
"Total ".$self->length."");
}
$start--;
if( defined $replace ) {
return substr( $self->seq(), $start, ($end-$start), $replace);
} else {
return substr( $self->seq(), $start, ($end-$start));
}
} else {
$self->warn("Incorrect parameters to subseq - must be two integers ".
"or a Bio::LocationI object not ($start,$end)");
}} |
sub validate_seq
{ my ($self,$seqstr) = @_;
if( ! defined $seqstr ){ $seqstr = $self->seq(); }
return 0 unless( defined $seqstr);
if((CORE::length($seqstr) > 0) && ($seqstr !~ /^([A-Za-z\-\.\*\?]+)$/)) {
$self->warn("seq doesn't validate, mismatch is " .
($seqstr =~ /([^A-Za-z\-\.\*\?]+)/g));
return 0;
}
return 1;} |
sub version
{ my ($self,$value) = @_;
if( defined $value) {
$self->{'_version'} = $value;
}
return $self->{'_version'};} |
General documentation
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bio.perl.org/MailList.html - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
bioperl-bugs@bio.perl.org
http://bugzilla.bioperl.org/
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
| Methods for Bio::IdentifiableI compliance | Top |
| Methods for Bio::DescribableI compliance | Top |
This comprises of display_name and description.
| Methods Inherited from Bio::PrimarySeqI | Top |
These methods are available on Bio::PrimarySeq, although they are
actually implemented on Bio::PrimarySeqI
Title : revcom
Usage : $rev = $seq->revcom()
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom"
The id is the same id as the orginal sequence, and the
accession number is also indentical. If someone wants to
track that this sequence has be reversed, it needs to
define its own extensions
To do an inplace edit of an object you can go:
$seqobj = $seqobj->revcom();
This of course, causes Perl to handle the garbage
collection of the old object, but it is roughly speaking as
efficient as an inplace edit.
Returns : A new (fresh) Bio::SeqI object
Args : none
Title : trunc
Usage : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,
Example :
Returns : a fresh Bio::SeqI implementing object
Args :
These are internal methods to PrimarySeq